1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grandymaker [24]
4 years ago
14

What does a hawk derive energy from

Biology
1 answer:
svlad2 [7]4 years ago
4 0
Hey You!

A Hawk Is A Quaternary Consumer, Which Means That It Can Eat Primary, Secondary, And Tertiary Consumers. The Hawk Is A Carnivore (Meat Eater) So It Gets Most of Its Energy From Meat.
You might be interested in
What is a deep steep sided Valley Formed by weathering and erosion called
Finger [1]
A Canyon is your answer.
3 0
3 years ago
A male is heterozygous for the trait that produces freckles on the skin, and he has freckles. if he marries a woman who is also
kakasveta [241]
<span>F- allele for freckles
f- </span><span>allele without freckles

1) The man is heterozygote and has freckles, its indicating that the allele for freckles is dominant.
A cross between him and a woman who is also </span><span>heterozygote: Ff x Ff
it would result in the following probabilities:
- 1/4 - homozygote with freckles: FF
- 2/4 - </span><span>heterozygote with freckles: Ff
- 1/4- </span><span>homozygote without freckles:ff

Their son would have a probability of 75% of being born with freckles.


2) The cross resulted in this probabilities:
</span><span><span>- 1/4 - homozygote with freckles: FF
- 2/4 - </span><span>heterozygote with freckles: Ff
- 1/4- </span><span>homozygote without freckles:ff
So, the chance of being born heterozygote for this gene is 2/4, which is the same as half (50%).
</span></span>
6 0
4 years ago
A trait is most likely to exhibit continuous variation if it is controlled by
baherus [9]

Answer:

A trait is most likely to exhibit continuous variation if it is controlled by <em>many gene loci, each with several possible alleles.</em>

3 0
3 years ago
choose the term that best completes the sentence: Absolute dating allows a scientist to determine the.. A: exact age of a sample
monitta
I think the answer would be a.
7 0
4 years ago
What is the the increase in metabolism that occurs during the digestion, absorption and metabolism of nutrients?
Keith_Richards [23]
Insulin released to prevent the surge of sugar in bloodstream when glucose increases.
4 0
3 years ago
Other questions:
  • Arrange the following terms in the correct order: Fertilization, sex cells, meiosis, zygote, mitosis.
    10·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A researcher would most likely employ an _______ in order to see which areas of the brain show the most activity while listening
    8·1 answer
  • After reviewing the laboratory reports of a patient, the nurse finds that the patient has a major injury at the sella turcica un
    12·1 answer
  • What is the opening in the cranial cavity where the spinal cord connects to the brain?
    12·1 answer
  • How can convergence lead to the formation of clouds
    10·1 answer
  • Please help me. I need the answers asap. This is due today. (ಥ﹏ಥ)
    15·1 answer
  • How many fundamental forces exist in nature?<br> two<br> three<br> four<br> five
    6·2 answers
  • Which nuetrom delivers info to the central nervous system
    9·1 answer
  • The codon chart demonstrates that more than one codon can potentially code for the same area on acid true or false
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!