1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marysya [2.9K]
3 years ago
7

What is site of gaseous exchange in an insect​

Biology
1 answer:
nataly862011 [7]3 years ago
4 0

Answer:

what are the answers? if I knew the answers I could tell ya

You might be interested in
In the structural organization of many eukaryotic genes, individual exons may be related to which of the following?
garri49 [273]

Answer: Option A

Explanation:

The tertiary structure of the protein is made of multiple domains. Every domain of the protein has different function allotted to them.

The exon is the functional part of the genetic material. The exon is part of DNA which encodes for the part of the mature RNA which is being produced once all the introns have been removed after splicing.

It is the main part which decides the respective domain of the functional protein.

8 0
3 years ago
Ridges and hills that separate two watersheds are called the…
Inga [223]
They are called the drainage divide.
5 0
4 years ago
Which of the following correctly describes the importance of the nitrogen cycle?
Stella [2.4K]
The answer is D To create ammonia needed by plants to create proteins.
8 0
3 years ago
How are babies made........Asking for a friend
Digiron [165]

Answer:

A male and a female have sexual interactions. While this, the male releases sperm cells which go into the females egg cells. This then forms into a baby and slowly grows. Then about nine months later the baby comes out of the females vagina.

5 0
3 years ago
How does a single cell function
olganol [36]

Answer:

They obtain nutrients, producing energy, and making proteins

Explanation:

7 0
3 years ago
Other questions:
  • A student looks at a slice of tissue on an unlabelled microscope slide. the student concludes that the tissue is not from an ani
    8·1 answer
  • Chloroplasts have an outer and an inner membrane that separate the stroma and thylakoid membrane from the cytoplasm. What is bel
    15·2 answers
  • Consumers that get energy by eating only plants
    15·1 answer
  • A(n) __________ infection is a small region of infection from which a pathogen may move to another part of the body to establish
    14·1 answer
  • Which of the following is the best example of a way human lifestyles affect environmental systems? -----------------------------
    9·2 answers
  • Please Help im not good at science (i can help you with math or english im good at those)
    12·1 answer
  • Which of the following is not a use for transgenic organisms?
    8·1 answer
  • Can someone help with this?
    12·2 answers
  • Why is DNA replication said to be semiconservative? (multiple choice)
    11·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!