1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mars1129 [50]
3 years ago
11

Damage to the brain can sometimes occur as the result of an accident.

Biology
1 answer:
Sladkaya [172]3 years ago
6 0

Answer:

A traumatic brain injury interferes with the way the brain normally works. When nerve cells in the brain are damaged, they can no longer send information to each other in the normal way. This causes changes in the person's behavior and abilities. The injury may cause different problems, depending upon which parts of the brain were damaged most.

You might be interested in
What can scientists observe over long periods of time to determine the patterns in climate change?
Jobisdone [24]

Answer:

The physical and biological changes that confirm climate warming include the rate of retreat in glaciers around the world, the intensification of rainfall events, changes in the timing of the leafing out of plants and the arrival of spring migrant birds, and the shifting of the range of some species.

Explanation:

6 0
3 years ago
Define Internal and external fertilisation​
Natali [406]

Answer:

see the file attached!!

8 0
2 years ago
How do living things (both plants and animals)get glucose and why do they need it?
guajiro [1.7K]
They get it from eating sugary foods and they need it for energy 
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Oil, coal, natural gas, and uranium are used to generate electrical energy. What is true about ALL of them
skad [1K]

none of it is renewable


5 0
4 years ago
Read 2 more answers
Other questions:
  • Which of the following terms describes a group of scholars who jointly study one issue?
    12·1 answer
  • Describe the different abiotic and biotic parts of an ecosystem. Identify and explain what organisms lie on each of the trophic
    6·1 answer
  • Which pair of terms are missing from A and B on the diagram?
    12·2 answers
  • If the ecosystem is balanced, which populations should be the largest? Which should be the smallest?
    15·1 answer
  • How does carbon cycle between the atmosphere and the biosphere?
    10·1 answer
  • Define the term dichotomous key if DICH- means in two and -TOMOUS means to cut.
    15·1 answer
  • What's the relationship between photosynthesis, chlorophyll, thylakoids, and chloroplasts?
    8·1 answer
  • On average, female Holstein cows weigh 1600 pounds and female Jersey cows weigh 900 pounds. If female Guernsey cows weigh an ave
    5·1 answer
  • Sasha is trying to separate a mixture of two liquids that each have different boiling points by heating them with a
    12·2 answers
  • The density of cristae is higher in mitochondria of the cell with higher rates of?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!