1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slamgirl [31]
3 years ago
10

Flock X

Biology
1 answer:
grandymaker [24]3 years ago
5 0

Answer:

                Total Pieces      Food Percentage   Simulated Number of Birds

              of Food Eaten                                      in Flock for 2nd Generation

Flock X          57                            19%                                 6

Flock Y          153                           51%                                15

Flock Z         90                            30%                                9

<u>Calculations. </u>

Food percentage:

Flock X = 57/300 * 100% = 19%

Flock Y = 153/300 * 100% = 51%

Flock Z = 90/300 * 100% = 30%

Simulated Number of Birds in Flock for 2nd Generation

Flock X = 19% * 30 = 6

Flock Y = 51% * 30 = 15

Flock Z = 30% * 30 = 9

You might be interested in
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
3 years ago
Sociology is the study of: (lo1.2) how urges, drives, and the mind account for human behavior. group-level dynamics and social s
melamori03 [73]
What is the question?
7 0
4 years ago
Lipid triglycerides made of
stiv31 [10]

Answer:A triglyceride is a lipid molecule made up of one unit of glycerol and three fatty acids, hence the tri- prefix, which means three. A triglyceride looks a little bit like a creature with three tails. The head is glycerol, which is a simple sugar alcohol compound.

Explanation:

3 0
4 years ago
Why does a psychologist want the results to be statistically significant?
stira [4]
Psychologists use statistics to assist them in analyzing data, and also to give more precise measurements to describe whether something is statistically significant. Analyzing data using statistics enables researchers to find patterns, make claims, and share their results with others.
3 0
3 years ago
please somebody help me with science Gel Electrophoresis what are the answer chioces for 1 through ten please whoever report is
AleksAgata [21]

1. A

2. C

3. D

4.B

5. A,B, and maybe C.

6. B

7. D

8. A and B

9. A,

6 0
3 years ago
Other questions:
  • Which characteristic do glycogen and starch share?
    9·2 answers
  • The situation in which allele frequencies in the gene pool of a population remain constant brainly
    13·2 answers
  • 3. What percentage of plants makes up the angiosperm group?
    15·2 answers
  • Describe the structure and function of transfer RNA (tRNA).
    13·1 answer
  • Explain why photosynthesis and cellular respiration are considered to be paired processes?
    7·1 answer
  • Can you please help me with my science class
    10·2 answers
  • A__ or change in a gene causes the disease hemophilia in 30% of cases of the disease.
    11·1 answer
  • How can we improve energy efficiency in:<br> a. Industry?<br> b. Transportation? <br> c. Buildings?
    9·2 answers
  • How does the tilt of a planet affect its temperature?
    12·1 answer
  • What types of weather events are not yet clearly linked to climate change?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!