1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
weqwewe [10]
3 years ago
5

PLZ HELP Translate this segment of RNA into the corresponding amino acids.

Biology
1 answer:
fomenos3 years ago
3 0

Answer:

Lysine - Isoleucine - Arginine - Histidine - Alanine - Valine - Asparagine - Alanine - Leucine - Glycine - Val

Explanation:

Translation is the second process of gene expression in which a mRNA sequence is used as template to synthesize an amino acid sequence. This process, which occurs in the ribosome, reads the nucleotides of the mRNA sequence in three's called CODON. Each codon represents an amino acid, which is then added to the growing peptide chain.

According to this question, the following mRNA sequence is given: AAA AUU CGG CAU GCC GUU AAU GCC CUC GGG GUG A. Using the genetic code, the following amino acid sequence is produced:

Lysine - Isoleucine - Arginine - Histidine - Alanine - Valine - Asparagine - Alanine - Leucine - Glycine - Val

You might be interested in
Have your ideas about what happens to molecules in the liquid, solid, and gas phase changed? If so, how? What evidence supports
Westkost [7]

Various states of matter have molecules moving at different velocities.

<h3>Molecules in matter</h3>

Matter is composed of molecules. These molecules that compose matter are in constant random motion. The kinetic energy and velocity of the molecules depends on the state of matter.

Molecules of a gas are fastest followed by molecules in a liquid. Molecules in a solid do not move at all hence solids have a definite shape.

Learn more about molecules: brainly.com/question/19922822

7 0
2 years ago
based on the flow of energy and biomass in ecosystem, determine the rough proportion of producers and consumers needed in the ec
Mila [183]
The number of producers is more than consumers and top carnivores in ecosystem. for example:- in the food chain of grass--goat--man,atleast 90% of energy is pasted to other level and 10% will be stored at that level it self. 
        grass                 goat                   man
       50/100               40/80                30/60.
as we human beings depend on plants and animals for our food for our whole life we need atleast 100 numbers of small plants for one week.
5 0
3 years ago
After the milk and bacteria ferment, what are the two parts that we separate?
Korolek [52]

Answer:

Latic acid and rennet cause the milk to curdle,which SEPARATES the curds.

4 0
3 years ago
What is a telophase
GREYUIT [131]
A telophase is the final phase of cell division, between anaphase and interphase, in which the chromatids or chromosomes move to opposite ends of the cell and two nuclei are formed.
6 0
3 years ago
Working as an environmental researcher does not require a college education
kap26 [50]
The answer is False :))
7 0
3 years ago
Other questions:
  • Theophrastus was considered the "Father of Botany" in the approximate year _____. 800 B.C.
    15·2 answers
  • A habitat is best described as _____.
    14·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Many fungi grow a mass of hyphae usually hidden within the material on which it is growing. What is this mass of hyphae called?
    5·1 answer
  • In a resting potential, an example of a cation that is more abundant as a solute inside a neuron than it is in the interstitial
    14·1 answer
  • Which of the following is true about DNA mutation
    13·1 answer
  • The cytric acid cycle requires the presence of _____ for completion
    10·1 answer
  • If (the first layer of your model) is sea level, what elevation is each of the following points?
    15·1 answer
  • Near a mid-oceanic ridge you can find...
    14·1 answer
  • Describe the development of the major parts of the brain and explain the functions of each part
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!