1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
3 years ago
6

I NEED HELP AS QUICK AS POSSIBLE!!!

Biology
2 answers:
andre [41]3 years ago
8 0

Answer:

a y

Explanation:

tangare [24]3 years ago
8 0
The answers are a and y
You might be interested in
Identify the structure of the human heart which is a large vein (right and left branches) that carries oxygenated blood from the
Dominik [7]
The pulmonary vein carries oxygenated blood from the lungs to the left atrium
6 0
3 years ago
What are two types of pioneer species
lisov135 [29]

Answer:

Plankons, fungi, bacteria, lichens etc. are the pioneer species of ecological succession.

Explanation:

7 0
3 years ago
HURRY
yuradex [85]

Scientists use all kinds of evidence in order to make sure that their claims are true.

4 0
2 years ago
How are meiosis and mitosis different ​
MAVERICK [17]

Mitosis is is two identical daughterter cells while meiosis results in four sex cells.

6 0
3 years ago
Many researchers hope pig organs will one day be successfully transplanted to humans. What would an advantage of successful pig-
Ivahew [28]
It would be a quicker and faster method.

4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • In which process is lactic acid formed when there is not enough oxygen present for cellular respiration to take place?
    15·1 answer
  • ALL veins carry:
    13·2 answers
  • The correct spelling for the term that means pertaining to the tail is:_____.a) cadal.
    8·1 answer
  • Which scientific tool is the best choice for use when a procedure says to obtain about 75 mL of a liquid? Why?
    7·1 answer
  • Nuclear energy is a useful source of power but has disadvantages. What is a disadvantage of nuclear energy?
    7·2 answers
  • What happens to cells in multicellular organisms as they continue to divide and increase in size?
    12·2 answers
  • Describe the two types of vascular tissue
    9·2 answers
  • The phenotype frequency in a populatin changews after each generation which would most likely be cause this
    12·1 answer
  • Prokaryotic cells are much
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!