1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cloud [144]
3 years ago
14

What type of dominance is it when BOTH alleles for a trait are expressed in offspring?

Biology
1 answer:
Ipatiy [6.2K]3 years ago
5 0

Answer:

Codominant

Explanation:

You might be interested in
The amino
zzz [600]

Answer:

1. Proteins.

2. Peptide Bonds.

Explanation:

I majored in Biology

3 0
3 years ago
Which of the following is an example of an organic molecule?
ivolga24 [154]

b because im trying to help hope it helps :)))


8 0
3 years ago
Read the passage. Then explain the ways humans have influenced the traits in corn plants and the impacts each biotechnology has
myrzilka [38]

Answer:

they have influenced it through genetic engineering

Explanation:

6 0
3 years ago
Read 2 more answers
David shows delayed intellectual development and has flattened facial features. The doctors explain that this genetic disorder i
Marysya12 [62]
David is likely suffering from Down Syndrome.
7 0
3 years ago
Read 2 more answers
Although there is an overpopulation problem with white-tailed deer in the Southeastern United States, hunting is regulated. Why
dimaraw [331]
Hunting is regulated because plants still need to be eaten by the deer. if they arent, a plant species grows uncontrollably and kills off other plants.
3 0
3 years ago
Other questions:
  • The integumentary system is an organ system consisting of the skin, hair, nails, exocrine glands, and sensory nerves. What is mo
    5·1 answer
  • Projection maps of earth are made in a variety of ways , such as the Robinson’s projection , Mercator projection, and conic proj
    15·1 answer
  • An organism that contains two of the same alleles for a trait is said to be _______ for that trait.
    5·1 answer
  • HELP!! 25 Points!!!
    5·1 answer
  • In your own words explain what the Continental Drift Theory states. Give two examples of evidence that support this theory
    5·1 answer
  • We use the classification system when grouping organisms, which are very diverse. which of these is the subgroup with the least
    6·1 answer
  • Afrikaners are a Southern African ethnic group descended from a very few Dutch settlers first arriving in the seventeenth and
    5·1 answer
  • What is the blood vessel going from the heart to the lungs​
    9·2 answers
  • Why is it difficult to make thermal active device?
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!