Answer:
The correct answer is explained below:
Explanation:
- Flooding and intrusion of salt water in the low lying areas can adversely affect human life. This can happen in the following ways:
- Flooding can cause many people to die due to drowning in the flood water.
- Many people lose their habitat and all their belongings due to the entry of water into the settlements having only the ground floors. These people need to rehabilitated to safer regions.
- The saline water percolates through the ground and mixes with the fresh water present in the water table, thereby making them saline and non-consumable.
- People have to face the dearth of food, drinking water, clothes and electricity until rescue operations are sent.
- Increased chance of transmission of water-communicable or water-borne diseases like diarrhoea.
A. Vili in stomach. And this is because of gluten.
Answer: The mutation occurred in this sequence is deletion.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
