1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
14

Por que es importante el sistema respiratorio? (Importancia del sistema respirtorio)

Biology
1 answer:
Mamont248 [21]3 years ago
5 0
Los pulmones y el sistema respiratorio permiten la entrada del oxígeno del aire en el organismo, así como la expulsión de dióxido de carbono al espirar. La respiración es el término que se utiliza para denominar el intercambio de oxígeno procedente del entorno por el dióxido de carbono que se produce en las células.
You might be interested in
Why are the filamentous body forms of slime molds (myxomycetes and acrasiomycetes), water molds (oomycetes) and the hyphae of fu
Sliva [168]

It is because convergent evolution represents the independent evolution of similar features in species that don't have the same ancestor. In this case filamentous body forms evolved independently, but have the same function: an adaptation for a nutrition of decomposers.

4 0
3 years ago
Read 2 more answers
How do lymphatic vessels differ in structure from veins?
rusak2 [61]
They are different in structure as one serves in an open system (lymphatic system) while the other serves is closed system (circulatory system).

Hope this helps!
*This question is common, so this answer I use a lot. I copied my own work.*
6 0
3 years ago
What is most likely to result when a mutation affects a DNA sequence?
stealth61 [152]

Answer:

A

Explanation:

If Im wrong pls correct me, I hope it will help

3 0
2 years ago
What are the main differences between plant and animal cells?
Licemer1 [7]

-Plant cells are more rigid due to the cell wall.

3 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Other questions:
  • Which method of genetic recombination is illustrated in the diagram?
    6·1 answer
  • The component of a homeostatic control system which transmits the response is called the .
    7·2 answers
  • Which of the following pairs of hormones are secreted by the posterior pituitary gland?
    8·1 answer
  • The Cycles of Matter
    11·1 answer
  • 50 Points!
    6·1 answer
  • The food source that is produced during photosynthesis is
    7·1 answer
  • How can invasive species affect biodiversity
    7·2 answers
  • Would a cell that did not undergo cytokinesis be able to function properly? Explain.
    15·1 answer
  • How many carriers are on this pedigree?
    12·1 answer
  • What is the answer ?????
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!