1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
2 years ago
14

Describe one of the three types of volcanoes we discussed today

Biology
1 answer:
White raven [17]2 years ago
3 0

Answer: Shield, Cinder Cone, and Composite volcano.

Explanation: A shield volcano is a volcano that is formed with lava is very runny and spreads to a wide area and then cools to form a shield volcano. These are common at Hawaii.

A cinder cone volcano is the smallest volcano. It's made from minor eruptions and cinders. They're short and usually erupt for a short period of time. Mexico's Parícutin volcano, is a cinder cone.

Composite or stratovolcanoes are the most common type of volcano. They form from thick, less runny lava. Since it is so thick, it cools then makes the volcano taller. Mount st helens, in Washington state is a stratovolcano.

You might be interested in
What skill is a scientist using when she listens to the sounds that whales make
aliya0001 [1]
It is called echoloction
6 0
2 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Cross a homozygous dominant individual for brown hair with an individual who is blond hair . remember the starting are the paren
Vikki [24]

Answer:

The offspring will have brown hair(Hh)

Explanation:

The offspring will have brown hair(Hh) because of HH and Hh

3 0
3 years ago
A reproductive strategy of an oak tree more closely resembles that of a k-strategist because of which feature? select one:
PtichkaEL [24]
OK! so my best guess would be c

8 0
3 years ago
Light waves
nikklg [1K]
Hello,

I believe you're asking which option is true. If so, A) do not require a medium. Unlike mechanical waves, electromagnetic (or light) waves do not require a medium. It has been proven that light travels in a straight line. Light waves are, in fact, electromagnetic radiation, and they can travel in a vacuum. 


Faith xoxo
8 0
3 years ago
Read 2 more answers
Other questions:
  • Like animals, plants undergo cellular respiration to produce energy. Plants use oxygen and release carbon dioxide and water. Wat
    6·2 answers
  • Which of the following scenarios is representative of mutualism? a. Barnacles living on whales b. Bees pollinating flowers c. Bi
    14·2 answers
  • What is the best way to recognize a segmented neutrophil from other neutrophils is the?
    13·1 answer
  • Explain in detail the role of enzyme
    8·2 answers
  • Which three species will affect plants that grow rich in nitrates like broccoli or corn to grow: is it Pseudomonas Aeruginosa, E
    12·1 answer
  • Which flow chart best shows the relationship between the cell structures that are listed?
    12·1 answer
  • Please i need help !!!☹️
    10·1 answer
  • Oxygen-poor blood flows out of the heart and into the lungs. Nutrients and oxygen are sent to other cells and parts of the body.
    9·1 answer
  • Box A and Box B are both set in the sun at the same time and both have an initial temperature of 30 oC. After 30 minutes the fin
    7·2 answers
  • The plasma membrane of the sea urchin egg ______. A. is outside of the fertilization membrane B. releases calcium, which initiat
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!