I think the correct answer from the choices listed above is option A. During gene expression, a cell reads the instructions in dna and builds a protein based on those instructions. Gene expression <span>is the process by which information from a </span>gene<span> is used in the synthesis of a functional </span>gene<span> product.</span>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
respiration, waste production, food intake, cells, breathing
Sinks of carbon dioxide can be farms grasslands or forest