1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
N76 [4]
3 years ago
8

A student uses a liquid thermometer to measure the temperature of a substance in a beaker during science class. The teacher says

that the measurement is incorrect.
Which are the most likely reasons the liquid thermometer could have measured the wrong temperature? Check all that apply.

1. The thermometer was not calibrated electronically.
2. The software connected to the thermometer had errors.
3. The bulb of the thermometer was touching the beaker.
4. The thermometer's bulb was not submerged in the substance.
5. The student stirred the substance with the thermometer.
Biology
2 answers:
mamaluj [8]3 years ago
4 0

Answer:

3

Explanation:

Allowing the thermometer bulb to touch the beaker will result in inaccurate readings because the thermometer will conduct heat from the beaker. This will be worse especially if the beaker is not at temperature equilibrium with the liquid inside. Also, don't handle the thermometer until the temperature levels off.

slamgirl [31]3 years ago
4 0

Answer:

Explanation:

Whats the awnser?

You might be interested in
Which of the following best describes the what happens during gene expression?
hoa [83]
I think the correct answer from the choices listed above is option A. During gene expression, a cell reads the instructions in dna and builds a protein based on those instructions. Gene expression <span>is the process by which information from a </span>gene<span> is used in the synthesis of a functional </span>gene<span> product.</span>
8 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Characteristics common to plants and animals regarding growth and reproduction are ______.
Lelechka [254]

Answer:

respiration, waste production, food intake, cells, breathing

7 0
3 years ago
As the carbon moves around from sink to sink, what are some effects that could result?
Bezzdna [24]
Sinks of carbon dioxide can be farms grasslands or forest
6 0
2 years ago
Which of the following cell components are most involved in determining an organism’s traits?
kati45 [8]

Answer:

I believe its B or D

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement BEST describes a lifestyle with healthy eating habits? A. John and his family follow a diet plan that consists o
    12·2 answers
  • Please help with questions 5 throught 9
    7·1 answer
  • Cells are surrounded by water, and cells themselves are about 70-95% water. As a result, __________
    13·1 answer
  • Number of cell divisions in process of mitosis
    13·2 answers
  • Some transgenic animals grow faster because they have extra copies of growth hormone genes
    11·1 answer
  • Which organ do you feel is most important to the digestive process? Why?
    5·2 answers
  • 5. Which of the following sequences is an example of a point mutation of the DNA sequence -A-A-G-T-G-C-?
    14·1 answer
  • Along with having smooth edges and lacking organelles, red blood cells are also specialized to have a concave shape. How does th
    5·1 answer
  • Which of the following are part of the 10 essentials list
    7·1 answer
  • Which of the following has a stabilizing effect on equilibrium? A. Intraspecific competition B. Niches C. Interspecific competit
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!