1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
34kurt
3 years ago
9

Compare a lion and a deer. Which biotic and abiotic factors that each of these animals needs to live are the same?

Biology
1 answer:
r-ruslan [8.4K]3 years ago
6 0

Answer:

Abiotic: environment, water, temperature, space, wind (sniffing food),

Biotic: living food (plants, animals)

Explanation:

Abiotic is non living factors that happen on their own in the animals environment. Biotic factors are things that are living in the environment.

You might be interested in
Identify and describe the three invisible planes that divide the human body ?
LiRa [457]

Answer:

longitudinal (sagittal)

Coronal (frontal)

Transverse

5 0
3 years ago
True or false
ANEK [815]

Answer:

Explanation:

false

5 0
1 year ago
What hypothesis did Miller-Urey test in their experiment?
coldgirl [10]
Organic molecules can form in a reducing atmosphere. Good luck.
4 0
3 years ago
Read 2 more answers
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Which of the following would NOT be a constituent of a plasma membrane? Select one: a. messenger RNA b. phospholipids c. glycopr
Katyanochek1 [597]

Answer:

The correct answer is a. messenger RNA

Explanation:

The plasma membrane mainly contains lipids, proteins, and carbohydrates. Phospholipids make the bilayer of the plasma membrane. Carbohydrates can be found attached to proteins and lipids.  

The carbohydrates that are attached to lipids are called phospholipids and those with proteins are called glycoproteins. mRNA is the molecule which is not the part of the plasma membrane. mRNA is produced in the nucleus through the transcription process and is responsible for proteins formation.

So phospholipids, glycolipids, and glycoproteins are the part of the plasma membrane but not messenger RNA.

7 0
3 years ago
Read 2 more answers
Other questions:
  • How would crickets be broken down by our body
    5·1 answer
  • How do the scientists Mendeleev and Moseley differ on their arrangement for the periodic table?
    5·1 answer
  • A gene that masks the expression of a second gene is
    6·1 answer
  • The law of reflection states that if the angle of incidence is 38 degrees, the angle of reflection is ___ degrees.
    8·1 answer
  • I need answers for the Biology chapter 4 of photosynthesis and Cellular Respiration
    10·1 answer
  • A client with hepatitis c is admitted to a medicaldash–surgical unit. which medication does the nurse anticipate will be ordered
    8·1 answer
  • Can some wone help pls!
    11·2 answers
  • Please help I’ll give brainliest
    9·1 answer
  • Pls help me, ill mark!!!!
    6·1 answer
  • Bacteria are
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!