Dominant allele are represent by who?

2 answers:

5 0

the dominant allele is usually represented by a capital letter, while the recessive allele has a lowercase letter. Let's say that the gene for flamingo color is represented by the letter P. The pink allele is dominant, so it would get a capital P, but the purple allele is recessive, so it would get a lowercase p.

Yuki888 [10]3 years ago

5 0

Any allele that is Dominant is represented by a capital letter (Ex. DD or Dd) either is considered DOMINANT as the D that hold the dominant trait is expressed

You might be interested in

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0

3 years ago

What does Darwin's theory of evolution explain about the natural world?

Marrrta [24]

Darwins theory of evolution explains how modern organisms evolved over long periods of time through descent from common ancestors. Darwin meant that different, yet ecologically similar, animal species inhabited separate, but ecologically similar, habitats around the globe.

5 0

3 years ago

which condition is a population that descended from a small number of common ancestors more likely to have

lapo4ka [179]

decreased ability to survive changing conditions

Hope this helps

6 0

3 years ago

Katie has been diagnosed with breast cancer and is under significant stress. she is undergoing a series of chemotherapy treatmen

zzz [600]

Resistance stage of the general adaptation syndrome (gas)

Resistance stage is the second stage in which the body goes through series of changes while trying to resist or adapt to the stressor. For the question given above, according to Hans Selye, Katie is currently in the resistance stage of the general adaptation syndrome (gas).

6 0

3 years ago

1. How much force accelerate a bicycle and rider with mass 60 kg at 1.5 m/s?

NISA [10]

Answer:

Force, F = 90 N

Explanation:

Given that,

Mass of the bicycle and rider, m = 60 kg

Acceleration of the bicycle and rider, a = 1.5 m/s²

We need to find the force acting on the bicycle and rider to accelerate. Let it is F. Its force is given by :

F = ma

F = 60 kg × 1.5 m/s²

F = 90 N

So, the force acting on the bicycle and rider is 90 N.

7 0

3 years ago

Dominant allele are represent by who?​

Dominant allele are represent by who?