1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mylen [45]
3 years ago
8

1. The graph shows the distribution of the weights of individual dogs in a population of dogs

Biology
2 answers:
Natasha_Volkova [10]3 years ago
4 0

Answer:

I just did this for class. The graphs should look something like these ( see attachments)

They are in order of stabilized, directional, disruptive

Explanation:

ap3x :)

NikAS [45]3 years ago
3 0

Answer:

a

Explanation:

You might be interested in
What five factors affect photosynthesis and it's rate?
mixer [17]
There are more than 5 factors, but here are perhaps the most important ones:
1) Light: Light energy is a crucial component in photosynthesis, as it is the primary energy source of the process.
2) Carbon Dioxide: Another key ingredient in photosynthesis.
3) Temperature: There is an optimum temperature for photosynthesis that varies from organism to organism. Too cold or two hot, and rate of photosynthesis will be lower. 
4) Water - Like almost all life process, water is a key component in photosynthesis. 
5) Oxygen. A common misconception is that plants only "breathe in" carbon dioxide and expel oxygen. Plant cells actually require oxygen as well in order to function, and thus oxygen is a necessary part of photosynthesis. 
8 0
3 years ago
Read 2 more answers
50 POINTS!!!!!
kaheart [24]

Answer: (A) the time that two species have been evolving independently.

Explanation: The molecular clock is figurative term for a technique that uses the mutation rate of biomolecules to deduce the time in prehistory when<u> two or more life forms.</u>

8 0
3 years ago
Read 2 more answers
A concentration gradient affects the direction that solutes diffusion. Describe how molecules move with respect to the concentra
Shtirlitz [24]

Answer:a

Explanation: took it

3 0
3 years ago
Read 2 more answers
How is the Sun classified?
Andrew [12]

Answer:

The sun is classified as a star.

Explanation:

The sun is a star at the center of the solar system.

The sun is important in the following ways:

  • The sun's light has to be present for photosynthesis to occur thereby, it enables food production by plants.
  • The sun lights up the earth through its light rays.
  • It warms up the sea.
  • It provides heat for heating up the earth leading to production of water vapor that rises to form clouds.
  • The sun also provides vitamin D that is essential to living organisms health.
8 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • In all muscle cells, two kinds of protein filaments slide past each other to shorten the muscle cell and generate force. what br
    8·1 answer
  • Which of the following explains why cells differentiate?
    14·2 answers
  • In writing On the Origin of Species, Darwin synthesized ideas from other publications, as well as observations he made while voy
    11·1 answer
  • Which statement best explains why meiosis produces haploid cells rather than diploid cells?
    9·2 answers
  • How do trees interact with other organisms?
    10·2 answers
  • Can you help me with both
    15·2 answers
  • Help ASAP plsssss :))
    9·1 answer
  • Red blood cells are able to maintain homeostasis because they are bathed in blood, which is to the fluid in the cells themselves
    13·1 answer
  • PLEASE HELP WILL MARK BRAINELLEST!!!!!!!
    5·1 answer
  • You are working on research involving competition between animals. Which of the following resources do you not need to measure?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!