1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrews [41]
3 years ago
8

Use the following words correctly in a sentence: nucleus, chromosome, gene, DNA.

Biology
1 answer:
katrin2010 [14]3 years ago
8 0

Answer:

A nucleus is the membrane-bound organelle, and it has the chromosomes, and genes are made up from DNA.

Explanation:

You might be interested in
List 2 regulations for pesticides.
Tomtit [17]
Do uou possible have a picture
7 0
3 years ago
Diagram of gastrulation and neurulation?
kozerog [31]
Following gastrulation, the next major development in the embryo is neurulation, which occurs during weeks three and four after fertilization. This is a process in which the embryo develops structures that will eventually become the nervous system
8 0
2 years ago
Why is it important that in the early growth seedlings respond to geotropism?
Zina [86]

Answer:

Root geotropism provides multiple advantages to a plant's vitality and survival

Explanation:

5 0
3 years ago
Pls help if you know wither one of these
Nuetrik [128]

Answer:

sex cell and germ cells

Explanation:

6 0
2 years ago
What characteristic of water accounts for its properties of adhesion, cohesion, high specific heat, and nature as a solvent
KIM [24]
It has hydrogen bonds

7 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP ME
    11·1 answer
  • Which best completes the table?
    9·2 answers
  • What fraction of the offspring would be expected to have white hair?
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why do grass flowers are not brightly coloured?
    14·1 answer
  • What component of the lake ecosystem is living?
    10·2 answers
  • Which of the following is not an acquired trait of a human​
    11·1 answer
  • I’ll give brainliest!
    7·2 answers
  • Is it genetically the same or genetically different from the parents? Form an embryo that is genetically unique from the parents
    9·1 answer
  • Which material is a part of bedrock? <br><br>silt<br>plants<br>wood<br>water
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!