1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ede4ka [16]
3 years ago
5

Cell Division lab

Biology
1 answer:
notka56 [123]3 years ago
4 0

Answer:

Describe the process of DNA replication.  Include an explanation of the role of each of the three enzymes involved in your discussion.

Explanation:

You might be interested in
Can someone help me with this please:)
Usimov [2.4K]
The answer will be 3 normal and 1 with white fur + cross-eyed.
Hope it helps!

4 0
2 years ago
Nonfictional resources include things such as
dybincka [34]
Yes I’m going back home and green and I have to get a couple things to eat at my
8 0
3 years ago
What are the visible legs that appear when DNA strands coil and condense
sammy [17]

The answer is; chromosomes.

During interphase, the chromosomes are usually hard to visualize even under a microscope becaue they are long thin threads called chromatin. During the initiation of mitosis, the chromatin undergo structural changes that condense and shortens them  and they becomes visible to even a light microscope.  


7 0
4 years ago
The diagram shows a nerve cell. Which row in the table labels the diagram correctly?
Snowcat [4.5K]

<u>Answer</u>:

The row C shows the correct labelling .

<u>Explanation</u>:

  • <em>Neurons</em> are the cells of the nervous system that transmit and receive nerve impulses.
  • The basic structure of a neuron consists of the <em>cell body, the axon, and the dendrites. </em>
  • The<em> cell body</em> consists of the nucleus and thus contains the genetic material of the neurons. Emerging out from this are 2 types of extensions - dendrites and axon.
  • The <em>dendrites</em> are involved in receiving messages from the other neurons whereas the <em>axon</em> is responsible for conducting the electrical impulses away from the cell body.
3 0
3 years ago
Read 2 more answers
Explain the concept of a “mockingbird” provided by Atticus in Chapter 10. How could this be a symbol? Who could be considered a
pychu [463]
In How to Kill a Mockingbird, Atticus warns them not to kill a mockingbird, because it doesn't harm anybody. Boo Radley could be considered the mockingbird, because although he is away by himself and harming nobody, the children mock and disturb him.
3 0
3 years ago
Other questions:
  • Hi harshika<br>answer fast​
    10·1 answer
  • Why is it Important for stomach acid to maintain a pH of 2 ?
    13·1 answer
  • What material would be the best choice for the support beams of a building?
    10·2 answers
  • even though all of the grasshoppers weren't killed, they all were exposed to the insecticide, so when the mice eat them, they ar
    9·1 answer
  • Freshwater marshes occur beside rivers and oceans ? True or False
    10·1 answer
  • A local area's short-term atmospheric condiſions are known
    12·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • What is the name of the tiny air sacs in your lungs?
    5·2 answers
  • If a DNA segment has the nucleotides AGCCTAATCGCATATGCC, what would be the nucleotide sequence of the complementary RNA strand?
    5·1 answer
  • What happens if a cell is unable to destroy m-cyclin at the end of a cell cycle ?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!