1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gayaneshka [121]
3 years ago
6

What is true about cellular respiration and 2 facts about photosynthesis and cellular respiration

Biology
1 answer:
makvit [3.9K]3 years ago
3 0

Answer:

* The glucose needed for Cellular respiration is delivered by plants. Plants experience a process known as photosynthesis.

* Photosynthesis can be considered as the contrary process of Cellular respiration. Through two processes known as the light reactions and the dark reactions, plants can assimilate and use the energy in daylight. This energy is then changed over alongside water and carbon dioxide from the environment into glucose and oxygen.

* Since this is the contrary process of Cellular respiration, plants and animals are said to have a cooperative relationship. This implies that plants and animals live respectively and advantage from one another.

Explanation:

Cellular respiration is the process by which the substance energy of "food" particles is delivered and incompletely caught as ATP. Starches, fats, and proteins would all be able to be utilized as fills in cellular respiration, yet glucose is most normally utilized as an illustration to analyze the responses and pathways included.

You might be interested in
Amy quickly becomes the center of attention when she enters a room. She is a tall and attractive young woman who generally wears
masya89 [10]

Answer:

histrionic

Explanation:

Patients with histrionic personality disorder use their physical appearance, acting inappropriately seductive or provocative, to attract the attention of others. They have no sense of self-direction and are highly suggestible, often acting submissively to retain the attention of others.

Histrionic personality disorder is characterized by a widespread pattern of excessive emotionality and attention seeking. The diagnosis is by clinical criteria. Treatment is with psychodynamic psychotherapy.

Amy has many symptoms related to histrionic personality disorder, but only a professional diagnosis can confirm if she has the disease.

8 0
3 years ago
Will anyone do research on Cookies and Cookie sheets and not plagarise (U can look at websites just do it in your own words and
hram777 [196]
Hey can u break it down and give me some more info on the exact thing u have t right about i will do it for you...:)
6 0
3 years ago
Which reproductive method is the only one available to mosses and ferns?
elena55 [62]

Answer:

Alternation of generation with both sexual and asexual

Explanation:

In mosses, the dominant plant is called a gametophyte while in ferm the dominant is sporophyte. Gametes are produced by the gametophyte and fertilization occurs forming an embryo. The embryo develops into a plant called the sporophyte.

4 0
3 years ago
Which of the following describes exploratory analysis?
adoni [48]
What are the options?

Explanation:


3 0
3 years ago
Read 2 more answers
Which of the following is also called feline distemper?
Vitek1552 [10]

Answer:

panleukopenia

Explanation:

feline distemper is another name for the feline panleukopenia virus or FPV

4 0
3 years ago
Read 2 more answers
Other questions:
  • The nurse is assessing a client who has syndrome of inappropriate antidiuretic hormone (siadh). which finding in the client is c
    5·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Need help with earth science
    5·1 answer
  • A skin cell should generate an exact copy of itself. Through which process would this occur?
    12·2 answers
  • In biology, evolution explains exactly how life began on Earth<br><br> A. True<br><br> B. False
    14·2 answers
  • ____________________________ is the process in which humans chose the desired traits of an organism.
    13·1 answer
  • The common grackle is a species of robin-sized blackbirds that are common (hence the name) over most of the United States. Long
    5·1 answer
  • 3. A husband and wife have three children: two boys and one girl. The
    11·1 answer
  • PLEASE HELP. 100 pts!!
    15·2 answers
  • 1.3.4 How can teenage pregnancies be avoided? List FIVE ways.​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!