1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valentinak56 [21]
3 years ago
6

Function of nervous tissue​

Biology
1 answer:
iren [92.7K]3 years ago
5 0
Nervous tissue is found in the brain, spinal cord, and nerves. It is responsible for coordinating and controlling many body activities. It stimulates muscle contraction, creates an awareness of the environment, and plays a major role in emotions, memory, and reasoning. To do all these things, cells in nervous tissue need to be able to communicate with each other by way of electrical nerve impulses. The cells in nervous tissue that generate and conduct impulses are called neurons or nerve cells. These cells have three principal parts: the dendrites, the cell body, and one axon.
You might be interested in
Somebody help me please
Lina20 [59]

Answer:

I think it would be A

Explanation:

Sorry if its not

3 0
3 years ago
Research a tundra plant or animal that is being affected by climate change. What is the name of it? Where on Earth does it live?
Sonbull [250]

Answer:

Green turtles live in Tropical Ocean Waters they are affected by climate change, because sea levels rise and stronger storms will erode and destroy there beach habits.  

Explanation:

Couldn't find the outlook :)

6 0
2 years ago
Read 2 more answers
in the box below, please illustrate any enzymes and substrate. label the following key words in your illustration: enzymes, subs
iogann1982 [59]

Explanation:

  • Enzymes are biological catalysts that speed up biochemical reactions.
  • A substrate is the molecule that the enzyme acts upon and converts to product.
  • An active site is the part of the enzyme where the substrate binds to it. Active sites contain a specific amino acid sequence and conformation which make it easy for the substrate to bind.
  • Enzymes are stringently substrate specific i.e. only a certain substrate can fit in and bind to the active site of a specific enzyme, just like only one key can fit into a specific lock.

3 0
4 years ago
The variable that is measured is called______variable
Delicious77 [7]
It is the dependent variable.

8 0
4 years ago
3. If a complex molecule can be digested to produce sugars, then the original molecules should
ruslelena [56]
D. Carbohydrates are made of many sugars.
3 0
3 years ago
Other questions:
  • During which process do water molecules bond with elements in the minerals that make up rock to form new substances or solutions
    6·1 answer
  • Anders owns a struggling coffee shop and has just received devastating news: a nationally known competitor is moving in on the s
    13·1 answer
  • Unlike ionic bonds convalent bonds involve the
    12·1 answer
  • Both DNA and RNA nucleotides contain three basic components. Nucleotides contain all of the components listed EXCEPT
    12·1 answer
  • Which organism would be at the bottom of a food pyramid?
    12·1 answer
  • The diagram shows the position of earth during solstice. select the area that would be getting around 24 hours of daylight each
    5·2 answers
  • What are the similarities and differences of homeothermic organisms and poikilothermic organisms.
    15·1 answer
  • 59.33
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Explain the Identification methods
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!