1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
8

Does respiration increase or decrease atmospheric carbon?

Biology
1 answer:
cupoosta [38]3 years ago
8 0

Answer:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt. Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

You might be interested in
Describe the formation of an ionic compound.
natta225 [31]
Isn't this Chem?
a non metal and a metal
a metal transfers electrons to the non metal
the non metal gains electrons and becomes an anion (a negatively charges ion)
and the metal loses electrons and becomes a cation (a positively charged ion)
5 0
4 years ago
Propose 3 ideas for the development of drugs that could stop viral replication cycle
svp [43]
The strategy is to look for unique processes that occur in virus infected cells but not uninfected cells. Look at some of the enzymes encoded by viruses, and the processes they catalyze to find ideas for inhibiting virus replication.Antiviral drug<span>, </span><span>any agent that is used in the </span>treatment<span> of an </span>infectious disease<span> caused by a </span>virus. Viruses are responsible for illnesses such as HIV/AIDS<span>, </span>influenza<span>, </span>herpes simplex<span> type I (cold sores of the mouth) and type II (genital herpes), </span>herpes zoster<span> (shingles), viral </span>hepatitis<span>, </span>encephalitis<span>, infectious </span>mononucleosis<span>, and the </span>common cold<span>.</span>
7 0
4 years ago
Expermant laveas test strach
Vlad [161]

Answer:

Experimental Procedure:

Mix 10 drops of tincture of iodine with 30 drops of water to make an iodine solution. Put a cracker on a plate, and test it for starch using a drop of the iodine solution. Chew a second cracker for 60 seconds until it is completely mixed with saliva.

3 0
3 years ago
How does the amino acid sequence determine the structure and function of a protein?
pav-90 [236]

The Rules of Protein Structure. The function of a protein is determined by its shape. The shape of a protein is determined by its primary structure (sequence of amino acids). The sequence of amino acids in a protein is determined by the sequence of nucleotides in the gene (DNA) encoding it.

3 0
3 years ago
How much milk can a lactating woman produce in one day?
Ganezh [65]
Around 25 ounces, but it is based on demand. Many women have different amounts.
4 0
3 years ago
Read 2 more answers
Other questions:
  • . According to the Big Bang Theory, the universe began about ___
    8·2 answers
  • In any DNA molecule, the number of guanine bases will:______.
    8·1 answer
  • Single-celled organisms are able to maintain
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • i have a 5 M stock solution of kcl and i need a 400mM working concentration (1x). if i want to make a 10 ml of a 2x concentratio
    14·1 answer
  • The specialized soft tissue manipulation technique used to ease the pain of conditions such as fibromyalgia, movement restrictio
    13·1 answer
  • Which term identifies a light-absorbing pigment?
    12·2 answers
  • ANSWER AND I WILL GIVE BRAINLIEST AND POINTS!
    13·1 answer
  • What is a functional adaptation of a butterfly
    11·1 answer
  • Please help with this​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!