1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allisa [31]
3 years ago
8

All organisms in the kingdom Plantae Are

Biology
1 answer:
Salsk061 [2.6K]3 years ago
5 0

All organisms in the kingdom Plantae Are Plant

You might be interested in
For the student who requires more visual interactivity the best source to learn medical terminology
scoundrel [369]

try to use quizlet diagrams or use prefix and suffix to make a educational guess

8 0
3 years ago
Read 2 more answers
What is the dependent variable in the video set
ValentinkaMS [17]

Answer:

caffeine would be the dependent variable because it is feeding off of the control onion

7 0
3 years ago
Some carbohydrates, such as ______________, are used as structural material in plants. For most animals, foods that contain thes
pychu [463]

Answer:

Some carbohydrates, such as _Glucose______, are used as structural material in plants. For most animals, foods that contain these carbohydrates stimulate the digestive system as fiber.

Explanation:

<h2>please mark me brainliest please</h2>
4 0
3 years ago
Read 2 more answers
Describe how sugar is transported around a plant 6Marks<br>​
Bas_tet [7]

Answer:

Sugars move from “source” to “sink” ... Sugars produced in sources, such as leaves, need to be delivered to growing parts of the plant via the phloem in a process called translocation, or movement of sugar. The points of sugar delivery, such as roots, young shoots, and developing seeds, are called sinks.

Explanation:

u will get 10 out of 6

8 0
3 years ago
Read 2 more answers
Help ASAP!!!
Vanyuwa [196]

Answer:

1

Explanation:

Mostly because it was the BIGGEST thing that really happend during said event. The others happend yes but not as majorly as number 1.

6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The small pieces of rock plus plant and animal pieces are called?
    6·2 answers
  • Organisms that cannot photosynthesize and must get their energy by eating other organisms are called
    13·1 answer
  • Who has a larger vacule? plant cells or animal cells
    12·2 answers
  • For an animal living a diplontic cycle, meiosis is limited to?
    11·1 answer
  • Describe how gene flow can increase genetic variation within two neighboring populations
    13·1 answer
  • A thermometer is used to measure temperature in what metric unit?
    6·1 answer
  • The sun weathers rocks by______. A. Dissolving it’s minerals
    9·2 answers
  • MULTIPLE CHOICE:
    14·1 answer
  • Faeces mainly consist of undigested food.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!