1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
12

How does the strength of a sound field 1 meter from its source compare with its strength 4 meters away?

Biology
1 answer:
Katarina [22]3 years ago
4 0
Intensity is defined to be the power per unit area carried by a wave. Power is the rate at which energy is transferred by the wave. In equation form, intensity I is
I
=
P
A
I
=
P
A
, where P is the power through an area A. The SI unit for I is W/m2. The intensity of a sound wave is related to its amplitude squared by the following relationship:

I
=
(
Δ
p
)
2
2
ρ
v
w
You might be interested in
Which of these conservation tactics is the best way to reduce the pollution produced by a coal-burning power plant?
Amiraneli [1.4K]
Either C or D. I think C, but I'm not too sure...

6 0
3 years ago
Read 2 more answers
The abbreviation of the term that means pertaining to the back and to the front is:_________
Burka [1]

Answer:

PA

posteroanterior

Explanation:

3 0
3 years ago
Question 5 OT TU
dolphi86 [110]
=====|>WHAT DO YOU MEAN<|===== :/
3 0
3 years ago
Baby jake is born with a narrowing of the muscular ring that controls the outflow of food from the stomach. what is the name of
svlad2 [7]
<span>The disorder is know as Pyloric stenosis and is caused by the pyloric muscles thickening, preventing food reaching the small intestines.</span>
7 0
3 years ago
Which of the chains of amino acids corresponds to the nucleotide sequence aauggcuac
maxonik [38]
The sequence AAU GGC UAC is composed of three codons each of which codes for a different amino acid. AAU codes for the amino acid called threonine. GGC codes for the amino acid called glycine UAC codes for the amino acid called tyrosine. So the chain will read  threonine-glycine-tyrosine. There are 64 possible 3 - letter combinations of DNA coding units A, C, G and T. Of these, there are three stop or non- sense codons that do not code for any amino acid, while the remaining 61 code for different amino acids.
4 0
3 years ago
Other questions:
  • Which traits are challenges of life for all organisms? Choose all answers that are correct. A. reproducing B. getting sunlight C
    7·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A __ is a tumor that has spread through metastasis
    5·1 answer
  • The number of times per week that exercise is performed is known as ________. Intensity frequency regularity time
    10·1 answer
  • In the food chain, the frog is classified as a
    15·2 answers
  • In humans and other multicelluar organisms, whic substance plays a central role as an energy source?
    10·1 answer
  • What type of statement would the following be considered? "I'm not a Math person because I'm not smart enough."
    5·1 answer
  • All the nerve bundles of the body are routed through the backbone and are called the spinal :
    14·1 answer
  • Which best shows Anatomical position?
    11·1 answer
  • Could the world's
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!