1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darina [25.2K]
3 years ago
9

Which statement correctly describes how an organelle contributes to the ability of the cell to perform life functions?

Biology
2 answers:
xeze [42]3 years ago
7 0
A IT SENDS INFORMATION
Nesterboy [21]3 years ago
3 0
A it sends the information needed to perform life functions
You might be interested in
Which is an example of an external response to stimuli?
ira [324]
I believe it would be a because your body is stimulated to drink water when you are dehydrated
5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What are the components of animal cell
Phoenix [80]
<span>The components of animal cells are centrioles, cilia and flagella, endoplasmic reticulum, golgi apparatus, lysosomes, microfilaments, microtubules, mitochondria, nucleus, peroxisomes, plasma membrane and ribosomes. Lol I hope this is what you were looking for!</span>
7 0
3 years ago
Chemical reactions change subtances into different substances when the atoms
maks197457 [2]

Answer:

I am not sure but I think the answer is of first one.

4 0
4 years ago
Phytoplankton use sunlight to gain energy through photosynthesis. As a result of the Law of Conservation of Energy, phytoplankto
Mandarinka [93]

Answer: D: Measure the amount of energy in the phytoplankton and the amount of light entering the aquarium. Then measure the amount of energy in the phytoplankton after exposure to the light and determine the difference.

Explanation: This will describe the law as the amount of energy leaving the system will be the same as measured before exposure to light.

3 0
3 years ago
Other questions:
  • What are two ways cancer cells are different from normal cells
    5·1 answer
  • Which substance from the light- dependent reactions of a source of energy
    13·1 answer
  • The _____ , first proposed by ronald melzack and patrick wall, is a current explanation for how pain works
    5·1 answer
  • Which is a lymphocyte? A. Urethra B. B cell C. Amylase D. Macrophage
    10·1 answer
  • Why is water conservation important?
    15·1 answer
  • How does the geologic time scale further our understanding about the biodiversity on our planet
    8·1 answer
  • If mRNA had the codon GUA, what amino acid does that code for?
    10·1 answer
  • In F1, the F stand for ___, or _____
    11·1 answer
  • Abiotic and biotic factors in an ecosystem are interrelated. In nature, when one factor is changed or removed, the availability
    11·1 answer
  • Question 5 of 30
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!