1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allochka39001 [22]
3 years ago
12

Which helps prevent errors in DNA replication?

Biology
2 answers:
Phantasy [73]3 years ago
8 0
D. This is to “proofread” the DNA
neonofarm [45]3 years ago
6 0
Answer: Complementary base pairing reduces errors.
You might be interested in
Use the information gathered in the A Three Point Test Cross animation to answer the question. Genes H and K are linked and are
Snowcat [4.5K]

Answer:

3.5 percent (3.5%)

Explanation:

In genetics, <em>crossing over</em> or 'recombination' refers to the exchange of genetic material between non-sister chromatids of homologous chromosomes during meiosis I. The map units (m.u.), also known as centimorgans, represent a measure of genetic linkage between genes/<em>loci</em> located on the same chromosome. One map unit (1 m.u.) is equal to a 1 percent chance that two gene/<em>loci</em> (in this case, genes H and K) will be separated during meiosis by recombination. In the example above, it means that among their progeny, 3.5 percent (3.5%) will be recombinant for the two genes (H and K), and 96.5 percent (96.5%) will have the parental combination of these genes.

4 0
2 years ago
In DNA, only the _____ varies from one nucleotide to another. base phosphate amino acid sugar
Aleksandr [31]

Only the bases varies from one nucleotide to another.

4 0
3 years ago
Read 2 more answers
Which of the following statements correctly describes the difference between the leading and the lagging strands of DNA during D
Mrrafil [7]

The answer is; A & C

The lagging strand is replicated in fragments called Okazaki fragments, each initiated by a primer. The fragments are later joined into one strand by DNA ligase. Replication occurs by adding nucleotides to the 3’ end of a preceding nucleotide. Because the lagging strand is antiparallel to the leading strand, the replication of the lagging strand is in the opposite direction as the replication fork direction. This is why the lagging strand is replicated in fragments because replication is being carried out by a single DNA polymerase (moving in the direction of the replication fork) per replication fork.  


7 0
3 years ago
1) Why is the epicenter of the earthquake limited to two locations after you have data for him to seismograph stations?
frez [133]

Answer:

Answer for question 2:

It is important to receive data from three separate locations because the more we know  about the seismic waves and the places that they are more we gain for learning  about them.

Explanation:

7 0
3 years ago
If the parents have ab and o blood type what type is the childs?
yKpoI14uk [10]

Answer:

parents with AB and O blood types can either have children with blood type A or blood type B. These two types are definitely different than parents' blood types!

hope i helped. if i can get brainliest that would be great

4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What was thomas hunt morgan mai cotribute to science
    8·1 answer
  • How does temperature affect the amount of carbon dioxide that yeast cells produce
    8·1 answer
  • Explain the process of mitosis in a tissue culture for normal cells
    9·2 answers
  • Which statement correctly describes a scientific theory?
    14·2 answers
  • Which of the following statements about forest fires and the atmosphere is true?
    8·2 answers
  • How does mutation affect variation in a species
    6·1 answer
  • Bugyfd8rvddddddddddddh
    15·1 answer
  • Pond silk or water silk is the common name of......
    8·1 answer
  • Which human activity contributes to increased nitrates in ground water leading to harmful algae blooms and possible dead zones?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!