1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zubka84 [21]
3 years ago
8

Which is the largest group of organisms that can interbreed?

Biology
2 answers:
ludmilkaskok [199]3 years ago
4 0

Species is ya answer

irakobra [83]3 years ago
3 0
Population I suppose?
You might be interested in
Organism's traits depend on the____in its cells.
mr Goodwill [35]
2 fats
I took this test and I got it right
6 0
3 years ago
Which of the following statements concerning prokaryotic cells are true? Check all that apply.
Firdavs [7]

Answer:

They are typically smaller than eukaryotic cells.

The DNA of a prokaryotic cell is contained in the nucleoid.

Explanation:

There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

7 0
3 years ago
What energy transfer takes place in a food web?
babunello [35]

Answer:

Animals - Plants - Energy

Plants gain energy through photosynthesis, which is then eaten by animals, which gets eaten by animals, etc.

Then, Animals die, and the energy is passed on to the soil, which passes to the plant.

3 0
3 years ago
What are the eight different elements that cereal contains​
Luda [366]

earth, wind ,fire ,and air

5 0
3 years ago
Describing a plant and what it needs. Include descriptions of the stems, roots, leaves, flowers, buds. Describe why photosynthes
charle [14.2K]

Answer:

Taproot systems feature a single, thick primary root, called the taproot, with smaller secondary roots growing out from the sides. The taproot may penetrate as many as 60 meters (almost 200 feet) below the ground surface. It can plumb very deep water sources and store a lot of food to help the plant survive drought and other environmental extremes. The taproot also anchors the plant very securely in the ground.

Fibrous root systems have many small branching roots, called fibrous roots, but no large primary root. The huge number of threadlike roots increases the surface area for absorption of water and minerals, but fibrous roots anchor the plant less securely

Explanation:

8 0
3 years ago
Other questions:
  • Most aquatic plant life can be found in the littoral zone. T or F?
    13·2 answers
  • The pectoralis major muscle can be divided into groups of fibers superior, or __________, and inferior, or __________.
    11·1 answer
  • Precipitation that enters a watershed and is not absorbed into the soil is called _______.
    8·1 answer
  • A single occupancy padded cell for the temporary holding of inmates harmful to themselves and or others is a ____?
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The antibiotic rifamycin blocks synthesis of RNA from a DNA template. The most immediate effect would be to
    7·1 answer
  • Which organisms on the geologic time scale are now extinct?
    7·1 answer
  • Question 6
    8·1 answer
  • Why is S phase of the cell cycle important?
    12·1 answer
  • HURRRRRRRRRRRRRYYYYYYYYYYYYYYYYYYYYYYYYYYYY
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!