1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio039 [100]
2 years ago
7

When a star's supply of hydrogen begins to run out,it becomes a..​

Biology
1 answer:
djverab [1.8K]2 years ago
5 0

Answer:

it enters the "main sequence" phase of its life

Explanation:

You might be interested in
HELP ME ASAP! bbbbbb
vazorg [7]

Answer: I'm gonna say the answer is Mutualism.

8 0
2 years ago
Read 2 more answers
Gametes are _____.<br> A reproductive organs<br> B reproductive cells<br> C reproductive tissues
katen-ka-za [31]
<span>a mature haploid male or female germ cell that is able to unite with another of the opposite sex in sexual reproduction to form a zygote. b.

</span>
8 0
3 years ago
Read 2 more answers
What is the difference between standing crop and standing state?​
emmasim [6.3K]

Answer:

Explanation:

Standing crop is the biomass or living matter of biotic components of an ecosystem at a particular time. It represents the entire living matter (biomass). ... Standing state can be defined as the amount of inorganic nutrients found in an ecosystem. It represents the part of non-living matter.

4 0
2 years ago
Read 2 more answers
Which could be a primary source of energy in a food web?
Deffense [45]

Answer:

The plant which I think it says clover i can see

Explanation:

plants are primary sources of energy because it makes it own food and doesn't take form other animals.

6 0
2 years ago
What will most likely happen to a plant that does not receive any water?​
umka2103 [35]

Answer:

It will die

Explanation:

Plants need nutrients from the soil, water, and light from the sun to grow and stay alive. If plants did not get water, they would die. ... The two main things plants need water for are turgor, to keep the upright and make sure it doesn't wilt and for photosynthesis.

7 0
3 years ago
Read 2 more answers
Other questions:
  • Hypodermic needles frighten Janice. As she awaits a flu shot, Janice's _____ nervous system is probably going into overdrive as
    8·1 answer
  • How does a cell build tissue
    13·1 answer
  • Is an organic compound that aids enzyme function by combining with an inactive enzyme to form a catalytically active form?
    14·1 answer
  • A scientist is trying to determine the evolutionary relationships among species with very similar physical characteristics. one
    10·1 answer
  • Are hawks omnivore?<br> are snakes 1st predator?
    11·1 answer
  • When gains associated with illness outweigh the costs, _____________ may result.
    13·1 answer
  • Asexual reproduction involves...
    9·1 answer
  • Where does the cotton come from that is used to make clothing?
    10·2 answers
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • Reflections <br><br><br> 1-c <br> 2-d<br> 3-d<br> 4-c<br> 5-a
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!