1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
azamat
3 years ago
6

Phospholipids are molecules with two non-polar fatty acid "tails" that are Hydrophilic and

Biology
2 answers:
nordsb [41]3 years ago
5 0

Answer:

True

Explanation:

tending to repel or fail to mix with water.

AlladinOne [14]3 years ago
3 0
The answer is True, I’m sure of it
You might be interested in
What patterns can be used to identify the ancestry line of an organism
valina [46]
Phylogenetic trees are often used to track what evolved from what.
8 0
2 years ago
Need help plz and thank you
Helga [31]
I got quite Of bit of answers out of this
7 0
3 years ago
Now that you have come up with an equation that describes the relationship between amounts of different nucleotide bases in DNA,
Elza [17]

Answer:

The correct answer will be- 21, 29, 29

Explanation:

In a DNA sequence, the nucleotide base pairs on one strand of DNA are  complementary to the base pair on other strand of DNA.

According to the Chargaff rule, Adenine binds Thymine and Cytosine binds Guanosine which shows that the amount of A will equal T and the amount of G will equal C.

Therefore, when the amount of C is 21%, then the amount of G will be 21%.

To find amount of AT= 100-GC

                              AT= 100-42

                                AT= 58%

So, AT/2= 29% each

Thus, A=T= 29%

          G=C=21%

5 0
3 years ago
There are four types of biomes. true or false
grin007 [14]
The answer is false. there are five types of biomes.
4 0
3 years ago
Read 2 more answers
Among the invertebrate phyla, phylum arthropoda is unique in possessing members that have.
Ostrovityanka [42]

Answer:

Wings

Explanation:

The most unique feature among phylum Arthropoda is that some of its members have wings. No other invertebrate has winged species!

3 0
2 years ago
Other questions:
  • Birds and earthworms have a _ that stores and softens food
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A pond contains 500 fish, 100 of which have been tagged. You catch 50 fish. How many of them would you expect to be tagged? a. 5
    11·2 answers
  • A labor. atory method of cutting apart and recombining genes to produce recombinant DNA
    6·1 answer
  • Caffeine is an inhibitor of phosphodiesterase. Therefore, the cells of a person who has recently consumed coffee would have incr
    11·1 answer
  • Explain how the shape of a river's stream bed can affect the river's speed and its power to cause erosion.
    7·1 answer
  • What did James Watson and Francis crick discovered
    9·1 answer
  • A 1000 kg car speeds up from rest to 25 m/s in 10 seconds.how much force acts on the car?​
    11·2 answers
  • How should you punctuate a SHORT STORY title?
    12·2 answers
  • 2 On a hot day, dogs sweat through their paw pads
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!