Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
14amu
Explanation:
Given subatomic particles:
Number of protons = 7
Number of Neutrons = 7
Number of electrons = 7
Unknown:
Atomic mass unit; amu of nitrogen
Solution:
The atomic mass unit of a substance is the number of protons and neutrons in such an atom;
Atomic mass unit = number of protons + number of neutrons
This is because the mass of an atom is concentrated in the nucleus;
For the given specie;
Atomic mass unit = 7 + 7 = 14amu
oye no me lo de baja enviar y me tocó tomarle pantallazo de lo que estaba escribiendo y espero te ayude
