1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
3 years ago
12

Using the same, non-mutated sequence of DNA , repeat the process you just completed, but this time, for an insertion mutation. R

andomly insert a base.
Original DNA gene: GATCGATACCATTCGGCGCATACTTCG

A)The mutated DNA sequence; highlight the insertion mutation.

B)The resulting MRNA sequence for each mutation:


C) The resulting amino acid sequence for each mutation (you will need the codon wheel chart for this):

Note: Begin translation at the first start codon, AUG, that you see when reading the MRNA sequence from left to-right. Stop translating the sequence when you reach first stop codon in the reading frame.
Biology
1 answer:
Dima020 [189]3 years ago
4 0

Answer:

its b

Explanation:

A P E X verified

You might be interested in
Exercise scientists at an Olympic training center want to monitor athletes to determine at what point their muscles are function
RoseWind [281]

Answer:

The correct answer is option c, that is, lactic acid.

Explanation:

One can determine the anaerobic function of muscles by observing the levels of lactic acid buildup in muscles. The production of lactic acid in muscles takes place by the process of anaerobic respiration. At the time of rigorous training or exercise, one requires more amount of energy for a short burst of time.  

As oxygen is already used for higher purposes in the body, the levels of oxygen get reduced for performing any more activities. Thus, in order to generate more energy the process of anaerobic respiration takes place. Anaerobic respiration is the form of respiration that takes place in the absence of oxygen. In the process, one molecule of glucose gets transformed into two molecules of lactic acid, which gets accumulated in the muscles. This production of lactic acid provides a quick form of energy, which is utilized at the time of intense training and thus, one can check the anaerobic functioning of the muscles by observing the levels of lactic acid in the muscles.  

4 0
4 years ago
The _____ region of the left lower limb is proximal to the _____ region of the same limb
AlexFokin [52]
Answer: <span>femoral; crural

In referring location/region you can use proximal or distal. Proximal means closer to the body. It's the opposite of distal that would mean further to the body
Femoral (or thigh) is located nearer to the body than crural (or leg).</span>
5 0
3 years ago
Which cellular structure is responsible for the localized storage of chromosomal dna?
natita [175]
Chromosome is a structure that contains DNA molecules packaged around histone proteins, therefore carries the heredity material. Chromosomes number determines whether a cell is haploid (n) or diploid (n). A diploid cell has both set of homologous chromosomes while the haploid cell has only one set. Nucleus is the cellular structure that is responsible for the localized storage of chromosomal DNA.
3 0
4 years ago
What are two things that all non vascular plants share?
Zepler [3.9K]
<span>They do not have a phloem or xylem.</span>
4 0
3 years ago
What are the three main parts of an rna nucleotide.
mrs_skeptik [129]

The three main parts of RNA nucleotide are:

  • A nitrogenous base
  • A pentose sugar and
  • One or more phosphate groups.

4 0
2 years ago
Other questions:
  • When does nondisjunction occur which affects inheritance?
    11·2 answers
  • What is the study of fossils and past life called.
    5·2 answers
  • Energy is transferred between the atmosphere and hydrosphere by which two processes?
    11·2 answers
  • Through photosynthesis a simple sugar is produced. Where do the carbon atoms come from to produce this sugar molecule?
    6·1 answer
  • What do all celular activities in living organisms use as a source of energy?
    8·1 answer
  • What is difference between sexual reproduction and asexual reproduction?
    10·2 answers
  • This part of Earth's surface is where water is in solid form, including sea ice, lake ice, river ice, snow cover, glaciers, ice
    6·2 answers
  • Spider plants use which of the following asexual options
    5·1 answer
  • 1
    13·1 answer
  • Select the correct answer. What falls in the gray area between living and nonliving things? A bacteria B. mold C. virus D. yeast
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!