Answer:
This is known as incomplete dominance
Explanation:
The phenotype of a heterozygous organism can actually be a combination between the phenotypes of its homozygous parents.The heterozygous offspring and the incomplete dominance of the purple trait are a phenotypic intermediate between the parents
Answer:
2) motion of molecules
Explanation:
heat is a form of energy, molecules with more energy 'vibrate' more
Answer:
jayfeather loved halfmoon but it was forbiden
Explanation:
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
They're celled subsistence farmers, their farming practice is subsistence farming, where most of the product they grew or reared are for themselves and their families, they usually don't take the products to the markets for commercial purposes, instead those who do that are practising commercial farming.