1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Likurg_2 [28]
3 years ago
14

An important difference between a series and a parallel circuit is that a series circuit cannot have any breaks. A parallel circ

uit can have a break in one branch and the current can still flow through another branch.
Biology
1 answer:
Yanka [14]3 years ago
7 0

Answer:

Yes.

Explanation:

Parallel circuit are those types of circuits in which break in one branch does not prevent the flow of current in the circuit and the current can still flow through another branch because there are more ways through which the current moves to other sources while on the other hand, series circuit refers to those circuits in which break in one branch can prevent the current flow in the circuit and the other sources can't receive current due to broken of the connection.

You might be interested in
A botanist studying the inheritance of flower color found that when she crossed the offspring of two pure-breeding flower lines,
Gemiola [76]

Answer:

This is known as incomplete dominance

Explanation:

The phenotype of a heterozygous organism can actually be a combination between the phenotypes of its homozygous parents.The heterozygous offspring and the incomplete dominance of the purple trait are a phenotypic intermediate between the parents

6 0
3 years ago
Which of the following best describes temperature?
erma4kov [3.2K]

Answer:

2) motion of molecules

Explanation:

heat is a form of energy, molecules with more energy 'vibrate' more

6 0
2 years ago
2 points
sweet [91]

Answer:

jayfeather loved halfmoon but it was forbiden

Explanation:

3 0
2 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Farmers who grow only enough food to feed themselves
Serjik [45]
They're celled subsistence farmers, their farming practice is subsistence farming, where most of the product they grew or reared are for themselves and their families, they usually don't take the products to the markets for commercial purposes, instead those who do that are practising commercial farming.
7 0
3 years ago
Other questions:
  • What part of phospholipid is hydrophobic
    10·2 answers
  • According to the theory of the supercontinent cycle, what will probably occur in the future?
    5·2 answers
  • ________ affects greenhouse gases which creates global warming.
    15·2 answers
  • *Hedgehogs are nocturnal and hibernate during the winter. Which of the
    6·1 answer
  • Anyone wanna be my friend and answer a question can ocean waves freeze
    7·2 answers
  • Three parts of a nucleotide
    12·1 answer
  • What is the upper most layer of the Atmosphere? (Not exosphere rn)
    7·1 answer
  • Which of the following is not a major class of nutrients required by the human body?Select one:a. fiberb. carbohydratesc. protei
    12·1 answer
  • What are some of the functions of roots
    12·1 answer
  • Question 9 of 30
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!