1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
enyata [817]
3 years ago
6

Compare energy diagrams a and

Biology
1 answer:
mr Goodwill [35]3 years ago
6 0
D would occur more rapidly.
You might be interested in
Johanna took her little brother to the playgrond because he likes to swing
Dafna11 [192]

Answer:

the boy is in Kinetic energy

Explanation:

Because when he swings he isn't experiencing any forces towards him only the swing experiences potential energy

5 0
2 years ago
The Mid-Atlantic ridge is a type of
vredina [299]

Answer:

The Mid-Atlantic Ridge (MAR) is a mid-ocean ridge, a divergent or constructive plate boundary located along the floor of the Atlantic Ocean, and part of the longest mountain range in the world.

Explanation:

5 0
3 years ago
Why we should understand the global environmental problems??​
Nutka1998 [239]

Answer:

Environmental awareness is an incredibly important part of our lives. In order to protect the sustainability of the planet, everyone needs to commit to becoming more environmentally aware. Environmental degradation is detrimental and is jeopardising the long-term health and security of animals, plants and humans.

:)

8 0
3 years ago
Anyone know any good books to study exam style questions for 9th grade biology?
krek1111 [17]

Answer:

I'm not too sure specifically for 9th grade. Though I am in 12th grade right now and currently using the Edrolo biology textbook which is solely based on the key dot points/skills for the entire subject. They also include past exam questions or similar exam style questions both multiple choice and short answer for each topic and chapter within the book.

Explanation:

5 0
3 years ago
What are each of these blood vessels responsible for when it comes to transporting blood in the body?
Nitella [24]
Is veins in charge of transporting the blood
8 0
3 years ago
Other questions:
  • The image displays the embryological development of five groups of vertebrates. Based on the evidence illustrated in the image,
    10·1 answer
  • What large flat muscle moves up and down in order to bring air in and out of the lungs?
    14·2 answers
  • What early scientist published the Principles of Geology, published in 1830?
    6·1 answer
  • The capacity of organs to allow the body to cope with stress via extra, unused functioning ability is referred to as _____. orga
    11·2 answers
  • A mother has a blood type a and her son has a blood type o. Which blood types are possible for the father?
    9·1 answer
  • Which feature of the Sun is shown below? A. sunspot B. solar flare C. prominence D. magnetosphere
    14·2 answers
  • Name different ways in which<br> abrasion of rocks can happen.<br> Plz help ASAP
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Ill mark brain list plss help
    13·1 answer
  • All members of kingdom fungi live off of what?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!