1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
borishaifa [10]
2 years ago
6

Plz help asap! The availability of which of the following factors would directly limit the productivity of the Calvin cycle?

Biology
1 answer:
Dima020 [189]2 years ago
7 0

Answer:

II and II only

Explanation:

i just took the quiz and i got an A

You might be interested in
HELPPPPPP ASAPPPPPPPP HELPPPP
Andrei [34K]
Little to no agitation I’m pretty sure
3 0
3 years ago
Read 2 more answers
According to the fossil record found in these sedimentary layers, what conclusion can be drawn about the movement of life to lan
timofeeve [1]

The correct answer is: B) As land plants became more complex, animal life did as well.

This is because land could not be colonized by other organisms such as animals until land plants became established-there was nothing for animals to feed on.

So, plants were one of the earliest organisms to leave the water and colonize land.


6 0
2 years ago
Read 2 more answers
How do the three types of colorblindness differ in genotype and phenotype?
vfiekz [6]

Normal colour vision (trichromacy) refers to vision that uses all three types of light cones. People with defected trichromatic vision will be colour blind to some extent and these conditions are called anomalous trichromacy. Three types anomalous trichromacy ( one type of cone perceives light slightly) :

1. Protanomaly – phenotype: reduced sensitivity to red light

2. Deuteranomaly  - phenotype:  reduced sensitivity to green light

3. Tritanomaly – phenotype: reduced sensitivity to blue  

People can also have color blindess as the result of mutation, when loss of function of one cone occurs. This condition is called dichromacy. If there is complete color blindness or monochromacy, the person can’t distinguish any color from grey.

Color blindness is an inherited genetic disorder resulted from mutations on the X chromosome.

3 0
3 years ago
Why does Tupperware blow its top in the microwave?
sergeinik [125]
The heat inside the Tupperware causes an increase in pressure and when enough pressure builds, the atoms need somewhere to go and the seal at the top is easiest to break, so the top blows off.<span />
7 0
2 years ago
54:58
jarptica [38.1K]

Answer:

CORRECT ANSWER IS FALSE.

Explanation:

I JUST DID THE QUIZ

E2021

4 0
2 years ago
Read 2 more answers
Other questions:
  • Starting with the sun , what energy transformations take place when cows graze in a meadow
    7·1 answer
  • Burning fossil fuels always produce___
    5·2 answers
  • What causes an increase in the number and intensity of small earthquakes before an eruption?
    9·1 answer
  • Why does Meiosis have two sets of replications?
    12·1 answer
  • Which of the following is a type of heat transfer?
    7·2 answers
  • O
    15·1 answer
  • In genetics, what does a genotype of (Nn) signify?
    7·1 answer
  • What part of the DNA is responsible for the inheritance of trait
    12·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What part of the plant is the female reproductive structure that holds the stigma and the ovule?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!