1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
boyakko [2]
3 years ago
15

Using the word bank, label the parts of an animal cell. Each word will be used once.

Biology
1 answer:
Inessa05 [86]3 years ago
7 0

Answer: Using the diagram the labelled parts are identified and matches with the number given below:

1.) Golgi bodies

2.) Cell membrane

3.) Lysosomes

4.) Nucleus

5.) Mitochondria

6.) Vacuole

7.) Endoplasmic reticulum

8.) Ribosome

Explanation:

All living organisms (plants and animals) are made up of cells which are the structural and functional unit. This is because it is the basic organizational unit of life. These cells are made up of structures known as the CELL ORGANELLES. The present or absence of one or more of these organelles creates the difference seen in plant and animal cells. They are briefly describe below:

--> Golgi bodies: they are stack membrane-lined sacs which export materials like enzymes and hormones made from the cell.

--> Cell membrane: this is a flexible membrane made up of protein and lipids that prevents the cell contents from escaping

--> Lysosomes: They are small round sacs that contain digestive enzymes which break down substances.

--> Nucleus: This is the largest and the most important cell organelle. It contains a thread-like network of chromatin granules which is extended to form the chromosomes. The chromosomes contain DNA( which is the molecule that houses the hereditary information of the cell).

--> Mitochondria: this is the site of chemical energy conversions for all cell activities. It is thus often called 'power house'.

--> Vacuole: this acts as a store house for many substances including excretory products.

--> Endoplasmic reticulum: these functions to distribute proteins and other materials throughout the cell.

--> Ribosome: these are sites for protein synthesis. They are found free in the cytoplasm or attached to the endoplasmic reticulum.

You might be interested in
James was observing cells under a microscope. He observed some cells which had a layer outside the plasma membrane. What is this
irga5000 [103]
It's a cell wall, common to some types of cells, like plant cells (one notable component of the cell wall is <span>cellulose, which is exactly where we obtain it from</span>).
4 0
3 years ago
Read 2 more answers
During photosynthesis, specific pigments absorb light energy, which is then used to fuel the building of sugar molecules. Which
Andreas93 [3]

Answer:

Chlorophyll a- violet blue

Chlorophyll b - orange red

Carotenoids- green yellow

Explanation:

The three major plant pigments are chlorophyll a, chlorophyll b and carotenoids.

Various pigments are identified by their specific pattern of wavelength absorption in the spectrum of visible light. Chlorophyll a absorbs light in the violet-blue region, while chlorophyll b absorbs orange-red light. Chlorophyll a and b reflects or transmits green light hence they appear green. Carotenoids absorb light in the green - yellow region hence they reflect longer yellow, red, and orange light.

5 0
3 years ago
Compared to the amount of genetic information
miskamm [114]

Answer:

c. One half as much.

Explanation:

The amount of genetic information contained in a normal human sperm cell (23 chromosomes) is one-half as much the information contained in a normal human body cell (46 chromosomes). Sperm cells are produced during meiosis, a specialized division process that <u>reduces the number of chromosomes in half</u>, generating haploid daughter cells.

3 0
3 years ago
Which of the following would be produced during mitosis
spin [16.1K]

Answer:

mitosis is a process of cell division in which one cell is divided into two and the two cells produced are exacty similar to the parent cell. chromosome number cell size remains same.

mitosis plays an important role in growth of organisms.

Explanation:

4 0
2 years ago
Brainly is sensitive and limits words so have to put a pic . please answer
Dima020 [189]

Answer: C

Explanation:

7 0
2 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which layer of the eye completely surrounds the eye except for a dark, round opening called the pupil?
    13·1 answer
  • A plant absorbs 200 J/g of energy from the sun. A cow eats the plant and absorbs 20 J/g of energy. The cow is fed to a group of
    11·2 answers
  • What happens in a global convention cell?
    10·2 answers
  • What are the two autotrophic forms of metabolism​
    10·1 answer
  • Different between physical and biological aspect<br>​
    9·1 answer
  • The delivery of oxygenated blood to all tissues around the body involves what two life functions? A) Digestive and circulatory B
    11·1 answer
  • Imagine the CCA added to the 3' end of the tRNA consisted of DNA nucleotides. It (WOULD/WOULD NOT) be possible to connect an ami
    5·1 answer
  • The study and manipulation of dna on a molecular level is known as.
    14·1 answer
  • What causes<br> the wind<br> and ocean<br> currents?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!