All categories

3 years ago

Hepatitis "___" may be dormant in the body for years before the signs and symptoms appear.

1 answer:

4 0

Hepatitis 'C' may be dormant in the body for years before the signs and symptoms. Hepatitis A, B, and C are cause by a virus. Hepatitis A is also known as Infectious Hepatitis, Hepatitis B is also known as serum Hepatitis. Hepatitis C is a viral infection that causes liver inflammation, sometimes leading to serious liver damage, it spreads through contaminated blood.

You might be interested in

Which statement best explains why meiosis produces haploid cells rather than diploid cells?

Vanyuwa [196]

Haploid cells join to form an organism that has a complete set of chromosomes

6 0

3 years ago

Read 2 more answers

Name THREE ways Earth’s oceans affect your life.

nikdorinn [45]

Answer:

The ocean covers 70% of the global surface. Climate is affected by both the biological and physical processes of the oceans

Explanation:

Regulates the earths climate

5 0

3 years ago

Read 2 more answers

What type of communication coordinates actions between neighboring cells?

bija089 [108]

Answer: A. Chemical signal

Explanation:

Chemical signal is the type of communication which coordinates actions between neighboring cells .

This ability originated in single cells organisms and was essential for the evolution of multicellular organisms because after a cell receives a message, it is transferred across the plasma membrane and changes are brought about within the cell in response to this message.

5 0

4 years ago

Read 2 more answers

Write a summary of the role of RNA and how RNA is synthesized

monitta

RNA, touches nearly everything in a cell. RNA carries out a broad range of functions, from translating genetic information into the molecular machines and structures of the cell to regulating the activity of genes during development, cellular differentiation, and changing environments. RNA is usually catalyzed by an enzyme. RNA polymerase using DNA as a template, a process known as transcription. The enzyme then progresses along the template strand.

3 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago