1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Musya8 [376]
3 years ago
12

Describe an environmental factor that could

Biology
1 answer:
solniwko [45]3 years ago
7 0

Answer:

Exposure to chemicals or radiation is an environmental factor that could

influence natural selection and increase genetic  diversity.

Explanation:

There are several factors that could easily influence natural selection and increase genetic  diversity. one such factor could be exposure to chemicals or radiation.

Radiations can alter the genetic code and disrupt the DNA decoupling and coupling process thereby producing altered gene. This altered gene when interact with native parent gene can give rise to mutated offspring. The presence of mutated/altered allele increases the genetic diversity.

You might be interested in
I want to know why I got this question wrong, I answered Transcription
NeX [460]
It is translation. Transcription is from DNA to RNA and Translation is from RNA to proteins
4 0
3 years ago
If one strand of a dna molecule has the sequence of bases 5'-attgca-3', the other complementary strand would have the sequence _
Leokris [45]
A pairs with t
g pairs with c
so taacgt
5 0
3 years ago
Read 2 more answers
C6H12O6 is a type of..<br><br> A. amino acid<br> B. carbohydrate<br> C. polymer<br> D. protien
Nataly [62]
B. carbohydrate
C6H12O6 is the formula for sugar, and sugar is a carbohydrate.
7 0
3 years ago
Read 2 more answers
Explain how neuroprosthetic devices work.
Tju [1.3M]
Neuro means brain, and prosthetic is a part or a stimulator. So basically a neuroprosthetic device is a part that implanted in there brain to act as a part, or to stimulate a certain part of the brain to complete functions.
8 0
4 years ago
Read 2 more answers
Cole is making a pedigree chart for the dogs that he breeds. His chart will have shaded shapes to show dogs who carry the domina
nadya68 [22]
You could do this: do the same shape but one shaded and one not
To show that female expressed that trait
Hope this helps you

3 0
4 years ago
Read 2 more answers
Other questions:
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • The boxer crab, Lybia tesselata, carries a small pair of anemones in its claws. When approached by a predator, it waves the anem
    13·1 answer
  • All life must maintain an internal balance, despite environmental changes this called what?
    8·1 answer
  • After exploring the lab materials, including the Color Key, which statement below is
    7·1 answer
  • Mike is studying the phylogenetic tree for big cats. A big cat phylogenetic tree is shown. A bracket goes to clouded leopard and
    13·1 answer
  • Do you get all the energy from a piece of fruit you eat?
    8·2 answers
  • Experiment on carbon dioxide is necessary for photosynthesis
    6·1 answer
  • An amino acid molecule includes a central carbon atom bonded to _____, a carboxyl group, and a hydrogen atom.
    6·1 answer
  • What is considered the best source of energy for a predatory animal?
    7·1 answer
  • ASAP!! I am doing combined science higher can someone help me please
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!