1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lunna [17]
3 years ago
7

How is a fish similar to an oak tree?

Biology
2 answers:
Aleksandr [31]3 years ago
4 0
A fish and an oak tree are both living things that are made out of cells. They both need water and sunlight to live and they are carbon-based.

Hope this helped.
Radda [10]3 years ago
3 0
They are both living this and they are both made of cells

You might be interested in
About how many cells constitute the body of an adult
sdas [7]

About 37.2 trillion cells present in the body of an adult human.

8 0
3 years ago
You have just heard about a situation in which someone who was drunk vandalized a building and assaulted a security guard. From
777dan777 [17]

Answer:

C- Impair the ability to consider the consequences of acting impulsively

Explanation:

Alcohol consumption leads to an increase in the level of dopamine released in the brain, thus increasing pleasure. This increase in levels of dopamine can lead to impairment in reasoning and minor memory loss. With these factors, impulsive actions are more likely to occur. Aggressive behavior might eventually settle in, when euphoria eventually becomes depression.

5 0
3 years ago
How can an error in dna get us sick?<br> Pleaseeee explain!
Juliette [100K]

Answer:

Errors during Replication. DNA replication is a highly accurate process, but mistakes can occasionally occur as when a DNA polymerase inserts a wrong base. Uncorrected mistakes may sometimes lead to serious consequences, such as cancer. Mutations: In this interactive, you can “edit” a DNA strand and cause a mutation.

8 0
3 years ago
Is sharks and crocodiles closely related
VashaNatasha [74]

Answer:

More recent phylogenetic analyses, based on mitochondrial DNA, have suggested that the crocodile shark is closely related to either the megamouth shark or the sand sharks (Odontaspididae).

8 0
3 years ago
Osteocytes are bone cells. Collagen fibers and calcium salts are found in abundance between and among the osteocytes. The collag
Nana76 [90]

Answer:

Part of the extracellular matrix secreted by osteocytes. (Ans. B)

Explanation:

Cells which are present on bones are known as osteocytes. Bone is composed of extracellular matrix, and cells. There are three types of cells which are present in the bones:

1) Osteoprogenitor cells.

2) Osteoblast.

3) Osteocyte.

Extracellular matrix is composed of organic matrix consisting glycoproteins, proteoglycans, osteocalcin also known as calcium binding proteins, and osteonectin which anchors bone mineral to collagen.

7 0
3 years ago
Other questions:
  • Over time Pangaea broke apart to form continents. Which modern day continents composed Gondwanaland?
    11·2 answers
  • Why can the mrna strand made during transcription be thought of as a mirror image of the dna strand from which it was made?
    8·2 answers
  • Type of material transport that requires energy from the cell
    11·1 answer
  • A person shakes up vinegar and oil dressing before pouring it on salads. what is the chemical reason for doing this
    10·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What do astronomers use too calculate the age of the universe?check all dat apply?
    15·2 answers
  • Alphonse suffered a stroke, resulting in a lesion in his temporal lobe. Which of Alphonse’s perceptual or cognitive functions is
    5·1 answer
  • All cells are surrounded by a cell wall​
    10·2 answers
  • Select all of the ways that a fossil could get destroyed before being
    8·1 answer
  • Nêu 2 cách hoạt động của glutathion trong tế bào hồng cầu
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!