You can't hear sound on the moon because of space. Space is a vacuum so you can't hear anything unless there is a medium for it to travel through (like air)
<span> RNA was thought of as little more than a messenger between DNA and proteins, carrying instructions as messenger RNA (mRNA) to build proteins. However, RNA can do far more. It can drive chemical reactions, like proteins, and carries genetic information, like DNA. And because RNA can do both these jobs, most scientists think life as we know it began in an RNA world, without DNA and proteins.</span>
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
The answer is A: Collagen
