1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vsevolod [243]
3 years ago
7

Help pls!!!

Biology
1 answer:
Rashid [163]3 years ago
6 0
I think it’s masses (I’m not sure)
You might be interested in
You have cloned a gene for an enzyme that degrades lipids in a bacterium that normally lives in cold temps. you wish to use this
GaryK [48]
A) You would have to incorporate that gene into the bacteria's plasmid (genetic information that isn't in its main genome) so that it can use it and express its message. This is done using enzymes that cut that circular plasmid, insert the gene you want, and put the circular molecule back together. Once you have the bacteria with the plasmid in it, you replicate that bacteria, so all the resulting copies will have that gene and they'll express it.

B) If not enough protein is being produced it could be because you don't have enough bacteria, you'd need a bigger population. The medium the bacteria is in also should be optimal so that it can be as efficient as possible.
6 0
4 years ago
What would most likely happen if one or more parts of a cellular system failed to function properly? A. The system would no long
Dima020 [189]

B or D I am not sure yet but I think it is B or D.

7 0
3 years ago
A speeding driver sustained a closed-head injury in an acceleration/deceleration accident from striking a tree front end first.
Tanya [424]

multiple choices are;

1. Expressive speech, vision

2. Light touch, hearing

3. Sense of position, graphesthesia

4. Weber tuning fork test, cranial nerve I


Answer;

1. Expressive speech, vision

Explanation;

-TheCoup and contrecoup refer to a type of head injury and reference where the injury occurred relative to the point of impact.

-They are a type of traumatic brain injury that results in the bruising of the brain.

-A coup injury occurs on the brain directly under the point of impact while a contrecoup injury occurs on the opposite side of the brain from where the impact occurred.

4 0
4 years ago
Bar magnets placed on table may not point along N-S direction . Why? Give reasons.
Elenna [48]

Answer:

lt is because the magnetic field of the magnet is equal in magnitude to the Earth's horizontal magnetic field but it is in opposite direction

Explanation:

Thus the net magnetic field at these two points is zero

3 0
3 years ago
which statement explains why tilted layers of rack appear through the Tapeats Sandstone? A. The ground was uneven at the time th
klemol [59]
C. and the sandstone formed around the rocks which are most likely metamorphic
6 0
3 years ago
Read 2 more answers
Other questions:
  • Imagine a population of small animals. All of the animals in this population have short legs. They all eat the leaves off of the
    8·1 answer
  • How are mixtures and pure substances alike? How are they different?
    13·1 answer
  • Would anybody be willing to help me write my research paper? Contact me privately.
    6·1 answer
  • Which biome is commonly found near the equator? O tropical forest temperate forest O temperate grassland O coniferous forest
    6·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Millets have higher nutritional content than wheat and rice, so they are poised to make a comeback. Find out:
    10·1 answer
  • Which of these characteristics best represents a fatty acid molecule?
    9·1 answer
  • Which of the following happens when a cell divides?
    13·1 answer
  • Why are viruses not living??
    13·2 answers
  • An investigator would like to initiate a study to determine if the epidemiology of HIV infection is different in prisoner popula
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!