1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sladkaya [172]
3 years ago
5

How does the color adaptation help fish residing in the coral reefs?

Biology
1 answer:
ankoles [38]3 years ago
8 0

Answer:

it keeps them alive and unseen by their enemies. keeps them from getting eaten

You might be interested in
Use mitochondrion in a sentence
olga nikolaevna [1]
Mitochondrion a singular word for mitochondria is a "powerhouse" organelle of the cell.

<span>Mitochondrion is an important organelle in most living organisms because it is where biochemical processes of living organisms such as respiration takes place. The mitochondrion has a smooth outer membrane but a larger inner membrane. The inner membrane is about 70% protein and is very convoluted because that can even fit inside the outer membrane. Mitochondrion is the carrier of the Kreb's cycle in the matrix and it is responsible for the transfer of electron chain found in the cristae of the inner membrane.</span>

4 0
3 years ago
Cerebrospinal fluid circulates within the ventricles of the brain and in the subarachnoid space outside the brain. Cerebrospinal
irina1246 [14]

Answer:

true

Explanation:

Cerebrospinal fluids  is a  colorless fluid  that is secreted in the choroid plexus,and  circulates in the ventricles system  and sub -aranchinoid space  of the brain and spinal cord. its provides nutrients  to the surrounding  neurons, cushions the effects of trauma, pressure, acts as buffer and provides protection through immune  system .

it plays a vital role in regulating  blood flow, through a process called cerebral auto regulation,This is needed to maintain efficient cerebral blood flow of oxygen and other metabolites, and withdraw of metabolic wastes from the brain.

in order to analyze it to diagnose some neurological diseases  its sample is usually taken out in a process called lumbar  puncture.

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
A sample of well water is tested for its bacterial content in a plate count assay. A one-milliliter sample of the water is dilut
Sholpan [36]

Answer:

The original water sample contains 830,000 cells per milliliter.

Explanation:

A sample of well water is tested for its bacterial content in a plate count assay. A one-milliliter sample of the water is diluted in a 1:10 dilution series. One milliliter of the fourth dilution tube is plated in a pour plate. After incubation, the plate has 83 colonies, indicating that the original water sample contained 830,000 cells per milliliter.

6 0
3 years ago
List the 3 stages of cellular respiration.
Contact [7]
The three main stages of cellular respiration (aerobic) would include Glycolysis, the Kreb's Cycle and the Electron Transport Chain. The Krebs Cycle takes Citric Acid which is a derivative of Pyruvic Acid and converts this through 4 cycles into Hydrogen, carbon dioxide and water in the Mitochondrial Matrix.
5 0
3 years ago
Read 2 more answers
Other questions:
  • When cells are copied using excel's copy function, what happens to the data in the copied cells?
    7·1 answer
  • While working in a genetics lab over the summer, you isolated a true-breeding strain of wingless drosophila. after sharing your
    10·1 answer
  • Is gender the same as sex...?
    14·2 answers
  • Introns are deleted before a gene is transcribed from DNA to mRNA?
    14·1 answer
  • Prior to being swallowed, approximately _____% of starches in food are broken down in the mouth.
    13·1 answer
  • Brainpop newton's laws of motion worksheet answer key catagorize it answer
    6·1 answer
  • What are some things humans are doing to stop climate change in the tundra biome?
    11·2 answers
  • Which pathway crosses over in the medulla?
    9·1 answer
  • In a negative feedback system, the response of the effector
    8·1 answer
  • Which of the following describes how the protozoan Stentor overcomes cell size limitations?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!