1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vitfil [10]
3 years ago
10

In the water cycle in the form of rain or snow falls from the clouds

Biology
2 answers:
Verdich [7]3 years ago
6 0

Answer: precipitation

Explanation: Did the test and got a 100%

Tom [10]3 years ago
5 0

i dont understand what you are saying but water gets evaporated from the oceans due to the suns warmth all the water vapors condense, once the clouds get too heavy and there are too many water vapors in the cloud for it to handle, it percipitates (rains)

You might be interested in
Plate tectonics may affect organic evolution because movement of plates may cause a change in ____.
Alex777 [14]

Answer:

The correct answer would be b.  the environment.

Due to movement of tectonic plates the organisms would experience different environment. For example, different habitat, different food source et cetera.

As an adaptation to the changing environment different organisms would evolve in different species.

For example, in Galapagos island fiches had developed different sizes and shapes of beaks as a result of adaptation towards different environment.

5 0
3 years ago
Read 2 more answers
What are the appendages of a sea anenome called?
Natasha2012 [34]
They have their tentacles which house cells called<span> cnidocytes.</span>
6 0
2 years ago
1.
Andrej [43]

1.  DNA replication

2.Mitochondria transform chemical energy into electromagnetic energy.

3. It is constructed by connecting smaller monomer subunits.


4 0
3 years ago
Scientists often classify organisms into two
BigorU [14]

Answer:

b

Explanation:

this is because Invasive species are frequently generalists in terms of food, or habitat needs, have fewer predators in their introduced environments and are better able to exploit disturbances than their native competitors.

7 0
2 years ago
Match the description to the type of energy.
attashe74 [19]

Answer:

1)diaphragm vibrations- sound waves

2) Changing magnetic fields- Electrical energy

3)sound waves- Mechanical energy

Explanation:

A changing magnetic field induces an electromotive force and then an electric field which contains electrical energy

Sound energy is a form of energy that can be heard by humans. Sound is an example of a mechanical wave because it consists of physically oscillatory elastic compression.

A diaphragm is a thin surfaced cone used to produce sound. It is caused to vibrate using electromagnetic energy.

3 0
2 years ago
Other questions:
  • The nurse is teaching a new group of mental health aides. the nurse should teach the aides that setting limits is most important
    8·1 answer
  • Describe one of the many paths a carbon molecule can take through the carbon cycle.
    15·1 answer
  • Question 2
    6·2 answers
  • Porque os mamíferos tiveram tanto sucesso evolutivo?
    8·1 answer
  • Michael,a 43-year-old was in a serious car accident. He has a rigid and tender left hypochondriac region. His blood pressure is
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A plant can produce either purple flowers or white flowers. What is the probability of purple-flowered offspring if two plants t
    6·2 answers
  • Which statement is true about physical and chemical changes
    7·2 answers
  • The Truth About Milk Essay! Please read! Rate this from a scale of 1 - 10 and please share! Link leads to petition
    10·1 answer
  • According to the theory of evolution by natural selection, which of these statements is correct?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!