1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skad [1K]
3 years ago
10

___ It’s a nice sunny day with no clouds but it is very cold outside

Biology
1 answer:
Vaselesa [24]3 years ago
7 0

Answer:

..mmm.... high pressure I guess.....

...

and are you sure that the outside will be freaking cold with a freaking sun above ..??..

You might be interested in
Helpppp urgent
Amiraneli [1.4K]

Answer:D

Explanation:

7 0
3 years ago
A group of students is walking in the park, and one of them takes a picture of a pollen grain that is being blown by the wind. W
ioda

Answer:

Gene flow at work

Explanation:

4 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
5(a+4)-6a+1=12 plz help its due today
irga5000 [103]

Answer:

a = 9

Explanation:

5(a + 4) - 6a + 1 = 12

5a + 20 - 6a + 1 = 12

5a - 6a + 20 + 1 = 12

-1a + 21 = 12

     -21      -21

--------------------------------

-1a = -9

/-1     /-1

---------------------------------

a = 9

3 0
3 years ago
Read 2 more answers
Patrick is observing a stained slide of muscle tissue under a microscope. He observes alternating dark and light bands inside th
san4es73 [151]
"Skeletal muscles" is the one <span>probable source of these muscles among the choices given in the question. The correct option among all the options that are given in the question is the second option or option "B". I hope that this is the answer that you were looking for and it has come top your help.</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • The graph above was made by a South American biologist in the country of Brazil, after a long study on parrots. About 200 years
    13·2 answers
  • Which of these is a function of the xylem?
    13·1 answer
  • What's the answer to this question
    7·1 answer
  • A hypothesis that is not supported by the data that has been collected and analyzed is
    12·1 answer
  • What are hydrophytes, mesophytes and xerophytes.​
    15·2 answers
  • Wolf spiders carry their young on their backs. How does this help in their survival?
    6·1 answer
  • Which does climate affect?
    13·1 answer
  • What are energy-giving nutrients
    11·1 answer
  • HURRY 50 POINTS
    5·1 answer
  • Students were asked to draw a concept map of changes in matter at the molecular
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!