Biochemistry is the study of the actions of the main metabolic processes of living organisms, which are protein synthesis (DNA and RNA molecules, genetic codes and how they work, enzyme formation and function, etc), glycolysis (cellular respiration, aka the Krebs cycle/citric acid cycle to break down glucose molecules to release chemical energy and oxydative phosphorylation, the use of that chemical energy to form ATP molecules in which the chemical energy is put in a form the cell can use, and lipid chemistry (the study of the pathways in which fatty acids are formed into lipids and fat molecules and cholestrol formation and function).
Essentially, biochemistry covers the chemical reactions necessary for cellular and organism metabolism
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Multidisciplinarity draws on knowledge from different disciplines but stays within their boundaries. Interdisciplinarity analyzes, synthesizes and harmonizes links between disciplines into a coordinated and coherent whole.
The continental drift affects living organisms in that it causes changes in climates which puts selective pressure on organisms, causes changes in habitats, including when large amounts of shallow marine habitat were lost in the formation of Pangea. Additionally continental drift may cause an increase or decrease in competition among different species and also it happens so slowly that it does not affect living organisms
Where is the natural habitat at
