1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tems11 [23]
3 years ago
8

A population of 1,000 healthy, at risk people is monitored for one year starting on January 1st, and the development of cases of

chicken pox is noted. No one has chicken pox at the start of the investigation. Twenty people develop chicken pox on June 30th and forty people develop chicken pox on September 30th. Twenty-four people were lost to follow-up on March 31st, and twenty-four people were lost to follow-up on November 30th. None of those lost to follow-up had developed chicken pox prior to becoming lost. Assume that you can get chicken pox only once.
Required:
What is the cumulative incidence of chicken pox in this population during the one-year period from January 1st through December 31st?
Biology
1 answer:
masha68 [24]3 years ago
3 0

Answer:

\mathbf{cummulative \ incidence = \dfrac{60}{1000}}

Explanation:

We recognize that total occurrence equals new cases of disease over time divided by the number of people at risk at the onset.

Mathematically:

\mathbf{cummulative \ incidence = \dfrac{New \ cases \ of \ disease \ occurrence}{Number  \ of \ population \ at \ risk \ at \ onset}}

Given that:

Number of the population at risk = 1000 individuals

New cases during Jan 1 - Dec 31 = 60 because;

At 20 occurred on June 30 & 40 on Sept. 30) & no new cases were identified after that:

∴

\mathbf{cummulative \ incidence = \dfrac{60}{1000}}

You might be interested in
Which organ is the male copulatory organ? vas deferens/testes/ scrotum/ penis
shusha [124]
The penis is the male copulatory organ, so penis is the answer
5 0
3 years ago
Read 2 more answers
Which term is defined as the exact location where an earthquake occured
kkurt [141]

Answer:

Hypocenter is the exact location beneath the earths surface where the earthquake began.

hope it helps:)

7 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
How is the H1N1 influenza virus spread?
Keith_Richards [23]
It spread by person to person
8 0
3 years ago
Read 2 more answers
How does the way that matter cycles through an ecosystem differ from the way that energy flows?
VLD [36.1K]

Answer: Unlike the one way flow of energy, matter is recycled within and between ecosystems.

Explanation:

4 0
3 years ago
Other questions:
  • The process by which organ systems maintain a relatively stable internal environment
    7·1 answer
  • The unpaired cartilage of the larynx that is made of elastic cartilage and bends when you swallow is called the
    9·1 answer
  • How much water should you have in a severe weather emergency supply kit?
    5·2 answers
  • A scientist is developing a computer model to determine the maximum population size, or carrying capacity, of eagles and other b
    5·1 answer
  • In your own words, explain the processes responsible for the formation of a reverse fault.
    8·1 answer
  • A rock formation near Gainesville, Florida, was formed 530 million years 1
    7·1 answer
  • Plants are a source of ________.<br><br> food<br> fuel<br> medicine<br> all of the above
    13·1 answer
  • ASAP right now(picture) Brainliest, All the choose is the same you just put what go there for the 4 words you see in the picture
    14·1 answer
  • The graph shows ice core data that illustrate historical trends in the amount
    7·1 answer
  • Each day your body makes (.......BLANK.....) red blood cells.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!