1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paladinen [302]
3 years ago
15

Hey guys! im stuck on this hard question please save me lol

Biology
2 answers:
spayn [35]3 years ago
8 0

Answer:

1.chemical receptors

2. nerves carry signal to the brain

3. nerves carry signals to the muscle

4. the brain process these signals

5.  the shark changes direction and swims towards pray

Explanation:

Klio2033 [76]3 years ago
6 0

Answer:

1)chemical receptors in the nose sense odor particles in the water

2) nerves carry signals to the brain

3) the sharks brain processes the signals

4) nerves carry signals to the muscle

5)the shark changes direction to swim towards the prey

You might be interested in
I need help on these questions
charle [14.2K]

Answer:

2 out of 4 or 50%

2 out of 4 or 50 %

Explanation:

5 0
2 years ago
please urgent help... below is a diagram of a cart on a flat surface being acted upon by a force to the right. assume that frict
vlabodo [156]
Answer:
Decrease

Explanation:
Acceleration is inversely proportional to the mass of an object.
Acceleration decrease as the mass of the object increase

If u use the formula F=ma to calculate, you will get
a=0.5m/s2 for the first situation (m=10kg) and a=0.25m/s2 for the second situation (m=20kg)
4 0
3 years ago
What are some advantages and disadvantages of
andrew-mc [135]

Answer:Asexual Reproduction Sexual Reproduction

Advantages Time Efficient; no need to search for mate, requires less energy Variation, Unique., organism is more protected

Disadvantages No variation - if the parent has a genetic disease, offspring does too. Requires two organisms, requires more energy

Explanation:While asexual reproduction only involves one organism, sexual reproduction requires both a male and a female. Some plants and unicellular organisms reproduce asexually. Most mammals and fish use sexual reproduction. Some organisms like corals and komodo dragons can reproduce either sexually or asexually. But in the long term (over several generations), lack of sexual reproduction compromises their ability to adapt to the environment because they do not benefit from the genetic variation introduced by sexual reproduction

5 0
3 years ago
Read 2 more answers
What are the mechanisms by which aneuploidy and polyploidy are caused? What are the mechanisms by which aneuploidy and polyploid
sleet_krkn [62]

The correct answer is:

The principal cause of aneuploidy is chromosome nondisjunction during mitosis or meiosis. Polyploidy in nature can result either from the duplication of euploid chromosome sets from a single species or from the combining of chromosome sets from different species.  

Aneuploidy is a phenomenon when there is the presence of an abnormal number of chromosomes in a cell (an extra or missing chromosome). Usually it appears as a result of improper cell division (chromosomes don’t separate) and it can cause many genetic disorders.

Polyploidy refers to a state when there are more than two sets of chromosomes (one from mother one from father). Triploid (three sets of chromosomes) and tetraploid (four sets of chromosomes) chromosomes are examples of polyploidy. This phenomenon is most common in plants.

5 0
3 years ago
1. A student is completing a Punnett square for a trait (X/x) that is autosomal and inherited by the dominant allele. The father
zvonat [6]

Answer:

C

Explanation:

autsomsal means that it is not x-linked/ realted to gametes. Dominate means that it needs only one X to get the trait

Using the punnet square

             X       x

      x     Xx   xx

      x     Xx   xx

there is 2 X which means there is a 50% change that their child will get the trait

5 0
3 years ago
Other questions:
  • An organism is prokaryotic. based on this can you tell whether it is a member of eubacteria or archeabacteria
    13·1 answer
  • What is creative electrical energy is converted to mechanical energy
    9·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Skeletal muscle contraction requires large amounts of energy in the form of _____________________ in order to complete the seque
    15·1 answer
  • Which of the following nutrients are not organic molecules? carbohydrates, lipids, minerals
    5·1 answer
  • Offspring that are produced through sexual reproduction are usually similar, but never identical, to their parents.
    15·1 answer
  • Who proposed the idea that electrons are found in different energy levels around the nucleus
    10·2 answers
  • 1.17) What is one question you have about the study of life?
    13·1 answer
  • How does the heart keep the blood flowing throughout the body?
    5·1 answer
  • If you anwer these ill give free brainly give all stars and heart it
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!