Answer:
because of code q446tg89nb6 this post has been removed
Explanation:
because of code q446tg89nb6 this post has been removed
for more answers visit brainly.com
Answer:
According to Nutton, we are unable to identify any diseases familiar to us today because we are hampered by the great difference between ancient and modern understanding of the concept of 'a disease'.
The evidence or claim he makes to support this, is in his book "Seeds of Disease" where he states that during the ancient medicine practice, the interpretatation was not held nor rigorously or strict, employing words far looser metaphoric sense, interchangeably with what they had known from Galen instead.
Explanation:
Professor Vivian Nutton specialises in the history of the classical tradition in medicine, from Antiquity to the present, and particularly on Galen. He is currently co-editor of Medical History. Heirs of Hippocrates
, how they exercised their influence, and how they were received and interpreted over the centuries, are fascinating stories. It was taken over and translated into Latin, Arabic, Hebrew and a range of European languages.
His main work has focused around Galen of Pergamum (129–216/7 AD), the most prolific writer to survive from the ancient world, whose combination of great learning and practical skill imposed his ideas on learned doctors for centuries, and, secondly, on the development of medical ideas and practices in the Renaissance of the sixteenth century.
It is process of producing female gametes and called creation of ovum
<span> benefit of an uneven production of gametes in oogensis is
</span><span>One haploid cell receives the majority of the nutrients from the cytoplasm
</span>so i conclude option A is correct
hope it helps
Answer:
ubiquitin targets CDKs
Explanation:
Cyclins are named such because they undergo a constant cycle of synthesis and degradation during cell division. When cyclins are synthesized, they act as an activating protein and bind to Cdks forming a cyclin-Cdk complex. This complex then acts as a signal to the cell to pass to the next cell cycle phase.
Cyclins drive the events of the cell cycle by partnering with a family of enzymes called the cyclin-dependent kinases (Cdks). A lone Cdk is inactive, but the binding of a cyclin activates it, making it a functional enzyme and allowing it to modify target proteins.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
