1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kryger [21]
2 years ago
12

How is the rate of photosynthesis measured

Biology
1 answer:
Karo-lina-s [1.5K]2 years ago
6 0

Explanation:

The incoming and outgoing CO2 from the leaf chamber is measured by infrared spectroscopy with an infrared gas analyzer. The difference gives us the amount of CO2, from which the rate of photosynthesis can be calculated.

You might be interested in
Which organelle helps to support, strengthen, and protect the cell? not found in animal cells.
irga5000 [103]
Cell wall strengthens the cell

3 0
3 years ago
What would happen to the other organisms if the producers disappeared?
frez [133]
If the producer were to disappear then all the other organisms will either go extinct, survival of the fittest, or have to adapt to the change. 
8 0
3 years ago
Transcribe DNA___RNA. I need help​
Leni [432]

Answer:

T

C

G

A

T

A

Explanation:

Thymine pairs with Adenine.

Guanine pairs with Cytosine.

3 0
2 years ago
How are organisms different from one another?
Molodets [167]

Answer:

They inherit it from their parents or it is due to them living in a different environment.

Explanation:

4 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
3 years ago
Other questions:
  • Which characteristics best identify differences between intrusive and extrusive rocks?
    15·2 answers
  • Ou have a 44-year old male client with a resting heart rate of 68 bpm. if using the heart rate reserve method (karvonen formula)
    14·1 answer
  • In a certain population of rabbits, the allele for brown fur is dominant over the allele for white fur. If 20 out of 100 rabbits
    9·2 answers
  • WILL GIVE A BRAINLEST FOR RIGHT ANSWER
    15·2 answers
  • The maps below represent the same area of the Amazon rainforest over an 8-year period as humans moved into the rainforest. Fores
    15·1 answer
  • A hot body of rock is more likely to exhibit ______ than is a cold body of rock.
    9·1 answer
  • 8. Which of these is a behavioral adaptation?
    7·2 answers
  • Which class of bio molecule do the molecules in the table belong to?
    5·1 answer
  • HELP!
    10·1 answer
  • The exact reproduction of an individual from cellular tissue is called __________.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!