In 1998, Canada's highest court declared that Quebec could not legally secede.
Explanation:
Quebec is a province in Canada. It is one of the most developed provinces, one of the most populous, and one of the few that provide good living conditions. Unlike the other Canadian province and territories where the language and culture are English based, as they were part of the English colonies, or in one case Inuit based, Quebec is actually a province with French culture and language, as it was part of the French colonies.
The people of Quebec, having different ethnic and cultural background, do not like to be part of Canada, but instead they want to be independent. They have organized several referendums, all of which had the majority of the voters being for independence, but all of which were not accepted by the Canadian government and court.
This puts the people of Quebec in a weird situation, as they want to secede, but the highest court of Canada has made that illegal. If they hold a referendum it will not be accepted, and war of course is not of anyone's interest.
Some facts about Quebec are:
- Quebec City is its capital, while Montreal is the biggest city.
- It occupies more than 1.5 million square km.
- Its population is around 8.5 million.
- It has the second highest GDP in Canada.
Learn more about where were some of the English and French colonies in North America brainly.com/question/12640440
#learnwithBrainly
Answer:
Porosity is a characteristic of rocks that affects the rate of weathering.
Explanation:
The rocks of all types are weathering under the influence of natural factors/elements. The water, temperature, climate, humidity, precipitation, winds, ice, all have their say when it comes to weathering and each of them is dominant in some areas. It is not just them that affect the rate of erosion though, but also the type of rock and its characteristics.
One characteristic of the rocks that is very important for the rate of erosion is the porosity. The porosity is a characteristic that shows us how easy or hard the rocks let water or other liquids through them. If the coefficient is high, then the rate of erosion will be very high, but if the coefficient is low, then the rate of erosion will be also very low.
The correct answer would be false.
<span>Although Western Europe is very industrially developed, agriculture is the main form of land use.
Question 2 options:
True</span>
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
