1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vivado [14]
3 years ago
5

Someone pls help w this

Biology
1 answer:
dmitriy555 [2]3 years ago
3 0

Answer:

B.

Explanation:

You might be interested in
Look at the picture <br>​
Vinvika [58]

Answer:

What was the question of it

4 0
3 years ago
What is iron sulfide
Alex17521 [72]

Answer:

Iron(II) sulfide or ferrous sulfide (Br. E. sulphide) is one of a family chemical compounds and minerals with the approximate formula FeS. Iron sulfides are often iron-deficient non-stoichiometric. All are black, water-insoluble solids.

5 0
3 years ago
How can cloning be used to help endangered species?
UNO [17]

 By cloning and reproducing the an endangered species can help to prevent that particular species from going instinct.

Hope this helps. :) 

6 0
3 years ago
Speciation may occur when two populations become reproductively isolated from each other
azamat
<span>A collection of mechanisms, behaviors and physiological processes that prevent the members of two different species that cross or mate from producing offspring, or which ensure that any offspring that may be produced are sterile :)</span>
3 0
3 years ago
If a sample tests positive for glucose what can be assumed about the enzymes activity
salantis [7]

lab, we used Benedict's reagent to test for one particular reducing sugar: glucose. Benedict's reagent starts out aqua-blue. As it is heated in the presence of reducing sugars, it turns yellow to orange. The "hotter" the final color of the reagent, the higher the concentration of reducing sugar.

5 0
3 years ago
Other questions:
  • Which of the following statements concerning testosterone is not correct?
    7·2 answers
  • 35 POINTS HELP Which statement best describes the event shown in the diagram
    5·2 answers
  • Which of these is one of the results of the Schenck decision?
    12·2 answers
  • Which of the following natural factors is likely to support coastal dune formation?
    7·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Scientists such as Carl Sagan believed nuclear weapons posed a threat to the survival of humankind not only in terms of a nuclea
    11·1 answer
  • Which one is the right choice?
    13·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • 1. What codes for a protein?
    11·1 answer
  • A skin cell divides to make a new skin cell. Which component of cell theory does this best illustrate?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!