1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erik [133]
3 years ago
9

I need help with this. please explain your answer. thanks!​

Biology
1 answer:
Kruka [31]3 years ago
3 0

Answer:

D.

Explanation:

I think because there a people who don't have a large intestines and they live normal lives.

You might be interested in
Which structures are found in both prokaryotic cells and eukaryotic cells?
Vesna [10]
I think the correct answer from the choices listed above is option A. The structure that is found in both prokaryotic cells and eukaryotic cells is the cytoplasm. Other choices given might not be present in either cell. Hope this answers the question.
3 0
4 years ago
Read 2 more answers
Which of the following organisms undergo both photosynthesis and cellular respiration? Select all that apply. * 1 point Dogs tre
garri49 [273]
All plants: Trees, grass, and flowers. Plants go through photosynthesis through use of the sun in the time sun is available, and go through cellular respiration their entire lifespan.
7 0
3 years ago
PLEASE HELP!! QUESTION ON THE BOTTOM OF THE MIDDLE PART!!!
algol13
Often microevolution can lead to macroevolution as changes become more pronounced and two distinct species emerge. Both are caused by mutation, genetic drift, gene flow or natural selection. ... Therefore, it's undergoing genetic migration.
6 0
4 years ago
When listing the levels of organization in organisms from smallest to most complex, which level is just below organs in complexi
Ilia_Sergeevich [38]
Well, it starts at the very bottom

Cells
Tissues
Organs
Organ Systems
Organisms

The level below Organs is Tissues.

Thus, Tissues is the level just below organs in complexity.
6 0
4 years ago
Read 2 more answers
How do cells repair themselves?
kari74 [83]
The newly conceived embryo consists of stem cells that soon begin differentiating themselves into the different kind if mature cells. It turns out that during this differentiation process that proteasomes go to work, breaking down the damaged proteins and generally turning up the engine. hope this helps. ;))) <span />
8 0
4 years ago
Other questions:
  • Which plant will go through the process of photosynthesis more quickly? (number 2.)
    9·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which of the following is/are true?
    6·1 answer
  • What has happened to the population since 1997 of the West Nile Virus?? will mark as brainliest
    11·1 answer
  • Which of the following is not a phenomenon on the surface of the sun?
    15·1 answer
  • I need to know the answers to these
    6·1 answer
  • Gravity is the force of ______ between all objects.
    8·1 answer
  • Projections of future climate change vary widely. What is the primary source of uncertainty for how much earth’s climate will wa
    14·1 answer
  • What part of the plant is found at the tip of the pistil and receives pollen?
    6·2 answers
  • Describe the structure of a neuron. Include the cell body, dendrites, and axon in your description. How does the structure of a
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!