1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alisiya [41]
3 years ago
14

2. What evidence was found to support the different parts of cell theory?

Biology
1 answer:
lukranit [14]3 years ago
4 0

Answer:

The invention of the electron microscope allowed them to see organelles and other structures smaller than cells. There is variation in cells, but all cells have a plasma membrane, cytoplasm, ribosomes, and DNA. These similarities show that all life on Earth has a common ancestor in the distant past

You might be interested in
Which of the following are all examples of pollution
Soloha48 [4]
Burning fossil fuels
5 0
3 years ago
What is NOT an impact that an invasive non-native species has on an ecosystem?
hjlf
D!! is the correct answer bro good luck!
6 0
3 years ago
Respiration describes the exchange of gases between your blood and the outside air. cellular respiration ______
Tpy6a [65]
Is when you breathe in oxygen and exhale carbon dioxide
8 0
3 years ago
How are tropical rainforests and temperate forests different apex?
Sholpan [36]
I believe the difference is that Tropical rainforests are warm and moist while the temperate rainforests are cool. Temperate rainforests have four seasons; spring, summer, fall and winter, while tropical forests experience warm weather all year round and do not have the same set of seasons. Additionally; tropical rainforests experience much higher rainfall than temperate rainforests.
6 0
3 years ago
Read 2 more answers
2.
victus00 [196]

Answer:

this process is called transformation, and for the first time, Frederick Griffith observed this process, but he could not explain it.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What are the two functions of the respiration system?
    5·1 answer
  • Pablo wants to enter the science fair. Which question could be answered through scientific investigation?
    7·2 answers
  • What is the runoff pollution, and what causes it?
    11·1 answer
  • You observe a high proportion of malarial infections in a small village located in Angola. Malaria is caused by the protozoan Pl
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which of the following is accurate? Group of answer choices Any damaged ecosystem can be completely restored. Our understanding
    9·1 answer
  • Some inquisitive students found two slugs and wanted to take them to science class. The only container they could find was a use
    10·1 answer
  • Why do plants store their food?
    14·2 answers
  • Most of the oxygen in the atmosphere is made by algae. Where do most of the algae live?
    7·1 answer
  • How did the articles of confederation compare to the constitution in regard to sovereignty?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!