1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ainat [17]
3 years ago
12

Which carries information by copying an original sound?

Biology
2 answers:
katovenus [111]3 years ago
8 0

Answer:

Analog signal ..............

geniusboy [140]3 years ago
4 0

Answer:

analog

Explanation:

You might be interested in
Which of the following is an example of hybridization?
Trava [24]

Answer:

the answer is B hope this helps

8 0
3 years ago
Which of the following is a condition that must be met for a population or an allele to be in Hardy-Weinberg equilibrium?
ElenaW [278]
The answer is <span>D) Organisms in the population must express no mating preferences.

Some of the conditions that must be met for a </span><span>population or an allele to be in Hardy-Weinberg equilibrium are:

1. The population must be <u>very la</u><u>rge</u> - so A) could not be the right answer.
2. There must be <u>no migration</u> and population must be isolated - so B) could not be the right answer.
3. There must be <u>no mutations</u> - so C) could not be the right answer.
4. There must be <u>random mating</u>, which means there are <u>no mating preferences</u> - so, D) is the right answer.
</span>
3 0
3 years ago
Which of the following can best be attributed to the specific function of enzymes
Alla [95]

It's <u>D) an increase in reaction speed</u>

:-)

<em>Brainliest?</em>

5 0
3 years ago
Read 2 more answers
Meteorologist study how tornadoes and hurricanes form. What are the hoping to learn?
Ahat [919]
To find out how they form
7 0
3 years ago
Explain the important of insects​
grigory [225]
Answer: Insects create the biological foundation for all terrestrial ecosystems. They cycle nutrients, pollinate plants, disperse seeds, maintain soil structure and fertility, control populations of other organisms, and provide a major food source for other taxa


Facts about insects: Insects are pancrustacean hexapod invertebrates of the class Insecta. They are the largest group within the arthropod phylum. Insects have a chitinous exoskeleton, a three-part body, three pairs of jointed legs, compound eyes and one pair of antennae.
8 0
3 years ago
Other questions:
  • Dr. Garcia is performing an experiment to see how cell division in flies is affected by the addition of a certain protein, calle
    10·2 answers
  • Why is positive feedback helpful in blood clotting but unsuitable for the regulation of body temperature?
    5·1 answer
  • What modern animal is actually a dinosaur and shows how evolution leads to adaptive change? PLEASE HELP ME!!!!!!!!!!!
    7·2 answers
  • Identify the labeled structures. A B C D E
    15·1 answer
  • The size of a frog population in a pond remains fairly constant over a period of several years because of a. decreasing competit
    9·1 answer
  • Ozone in the troposphere is a good thing. <br> True or false
    13·2 answers
  • How is energy conserved during cellular respiration?
    10·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • The Food Pyramid suggests that a healthy diet consists of a large portion of:
    7·1 answer
  • trobriander households produce more yams than they can possibly consume in order to give most away. in so doing, a trobriander m
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!